UNIVERSIDADE FEDERAL DE CIÊNCIAS DA SAÚDE DE PORTO ALEGRE PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS DA SAÚDE Virgínia Meneghini Lazzari A ausência de ocitocina altera comportamentos sociais e o padrão de expressão gênica hipocampal e a experiência sexual influencia a morfologia dos espinhos dendríticos no hipocampo de camundongos machos Porto Alegre 2017 Virgínia Meneghini Lazzari A ausência de ocitocina altera comportamentos sociais e o padrão de expressão gênica hipocampal e a experiência sexual influencia a morfologia dos espinhos dendríticos no hipocampo de camundongos machos Tese submetida ao Programa de Pós- Graduação em Ciências da Saúde da Universidade Federal de Ciências da Saúde de Porto Alegre como requisito para a obtenção do grau de Doutor Orientadora: Profa. Dra. Márcia Giovenardi Co-orientadora: Profa. Dra. Silvana de Almeida Porto Alegre 2017 (FICHA CATALOGRÁFICA) Virgínia Meneghini Lazzari A ausência de ocitocina altera comportamentos sociais e o padrão de expressão gênica hipocampal e a experiência sexual influencia a morfologia dos espinhos dendríticos no hipocampo de camundongos machos Tese submetida ao Programa de Pós- Graduação em Ciências da Saúde da Universidade Federal de Ciências da Saúde de Porto Alegre como requisito para a obtenção do grau de Doutor. Porto Alegre, 31 de março de 2017. BANCA EXAMINADORA Profª Dra. Rosane Gomez Prof Dr. Márcio Donadio Profª Dra. Wania Aparecida Partata Profª Dra. Taís Malysz AGRADECIMENTOS Agradecer a todas as pessoas que foram importantes na realização desse trabalho não é uma tarefa fácil. Quero trazer para dentro do meu texto aqueles que já o percorrem nas entrelinhas... Não só aos que me ajudaram efetivamente na construção dessa tese, mas aos amigos e colegas que partilharam comigo ideias, fomentaram discussões, que me trouxeram paz, que confiaram no meu potencial e me estimularam a acreditar em meu trabalho. Acho justo começar agradecendo à minha orientadora, profª Marcia Giovenardi. Durante dez anos como sua aluna, inúmeros foram os ensinamentos e momentos bons vividos em tua companhia. Muito obrigada por todos os ensinamentos e conselhos, todos os momentos de convívio, as alegrias e tristezas compartilhadas, o ombro amigo nas inúmeras situações difíceis que enfrentei nos últimos tempos, os conselhos nos momentos em que precisava de um norte... Termino esta etapa da minha vida com a certeza de um crescimento profissional e pessoal imensos e de que tua ajuda e orientações foram essenciais para que este crescimento fosse possível. Muito obrigada por tudo! Quero registrar aqui meus mais profundos agradecimentos à minha amiga Roberta Becker, que além de ser a pessoa diretamente mais envolvida na realização dos experimentos, foi meu braço direito ao longo de toda essa jornada! Roberta, teu carinho, tua presença tranquila e tua amizade foram essenciais na minha vida nesses últimos dez anos. Chegar ao final do doutorado e te ter ao meu lado para dividir esta vitória é uma alegria pra mim, pois este trabalho não é só meu, é teu também! Obrigada por todos os bons momentos e pelo carinho! Meus sinceros agradecimentos à Josi Maria, que foi minha companheira nos experimentos de biologia molecular, nas visitas congelantes ao -80°C, minha gêmea de tragédias e alegrias, minha querida amiga! Muito obrigada pela ajuda e pelos bons momentos que compartilhamos. Agradeço à Grasiela por toda a ajuda na biologia molecular, por todos os conselhos e empréstimos de reagentes, por todos os bons momentos vividos juntas e pela amizade linda que construímos e que eu vou levar para a vida toda! Não poderia deixar de agradecer à Ana Carolina, minha amiga querida que nos ajudou no início das padronizações dos testes da biologia molecular, nos passou os passos das PCRs em tempo real, nos mostrou as análises logarítmicas... E além disso foi uma companheirona de congressos. Te desejo tudo de mais lindo Ana, obrigada por tudo! Agradeço ao professor Alberto Rasia-Filho pelas contribuições ao trabalho e pelos momentos divertidos. Escolher a menor área do hipocampo e me dispor a analisar lâminas difíceis (praticamente impossíveis) e, ao estar com a tese pronta para entregar e ter que voltar à bancada para tornar o trabalho mais adequado, não foi fácil! Por alguns momentos pensei que depois desta, vou direto para o céu! Dificuldades à parte, eu tenho certeza que a sua contribuição foi o diferencial no delineamento do artigo dos espinhos e tenho a convicção de que estaremos apresentando a tão citada ―verdade científica‖! Agradeço também à minha co- orientadora, professora Silvana Almeida, por toda a ajuda nos testes, na escolha e compra dos reagentes e nas análises dos dados da biologia molecular. O artigo de expressão não seria possível sem a sua ajuda! Agradeço aos meus pais e à minha irmã pelo amor incondicional, pelo apoio e confiança no meu trabalho. Aos amigos próximos, que ouviram as dificuldades enfrentadas, que estiveram ao meu lado nos momentos difíceis em que tudo dava errado e que também estiveram ao meu lado comemorando minhas vitórias! Agradeço à minha terapeuta, Patrícia, que vem me ajudando a enfrentar os acontecimentos do último ano, que me aconselha e me acalma nos piores momentos. Pati, sem a tua ajuda, tenho certeza que não estaria escrevendo estes agradecimentos... Muito obrigada! Finalmente, agradeço ao meu melhor amigo e marido, Rafael. Amor, obrigada por toda a ajuda, todo o apoio, incentivo e compreensão... Teu amor foi minha base e tua amizade meu amparo, obrigada por compartilhar a vida comigo! RESUMO Os comportamentos sociais, essenciais para a manutenção das espécies, são modulados pelo neuropeptídeo ocitocina (OT). Importantes funções relacionadas aos comportamentos sociais tais como a motivação sexual, interação social, memória e respostas emocionais são moduladas por estruturas do sistema nervoso central (SNC), tais como bulbo olfatório (OB), hipotálamo (HPT), córtex pré-frontal (PFC) e hipocampo (HPC). OT, vasopressina (AVP), dopamina (DA) e estrogênio, bem como seus respectivos receptores (OTR, V1aR, V1bR, D2R, ERa e ERb) atuam sobre estas estruturas. Variações nos receptores e nos neurotransmissores se refletem na morfologia dos espinhos dendríticos de neurônios envolvidos e nos desfechos comportamentais observados nestes roedores. Este estudo teve como objetivo analisar o impacto do nocauteamento do gene da OT nos comportamentos sexual e de interação social; na síntese hipotalâmica de AVP e na expressão gênica dos receptores de OT, AVP, DA e estrogênio no OB, HPT, PFC e HPC. Além disso, analisar o impacto do nocauteamento do gene da OT e da experiência sexual na densidade e morfologia de espinhos dendríticos na área CA2 do HPC de camundongos machos. Camundongos C57BL/6J foram genotipados para o grupo controle (WT) e para o grupo nocaute para OT (OTKO). Os testes de comportamento sexual foram realizados com camundongos com experiência sexual compondo os grupos WT (n=13) e OTKO (n=12). Os testes de interação social utilizaram machos após uma semana de isolamento social para os grupos WT (n=8) e OTKO (n=11). Após os testes comportamentais, 6 camundongos WT e 8 OTKO foram eutanasiados e o sangue foi coletado para análise de AVP plasmática. Nossos resultados mostraram que no teste de interação social, OTKOs mostraram níveis mais baixos de comportamentos sociais, menor dominância e níveis mais elevados de comportamentos não- sociais que os WT. Na análise etológica, o grupo OTKO apresentou menor desempenho agressivo e maior investigação social que o grupo WT. Não foram observadas diferenças significativas no comportamento sexual, por outro lado, encontramos menores concentrações plasmáticas de AVP no grupo OTKO em comparação com o grupo WT. Para a análise da expressão gênica, camundongos foram genotipados e alocados no grupo WT (n=10) e no grupo OTKO (n=10) e tiveram suas estruturas encefálicas (OB, HPT, PFC e HPC) coletadas. Para a expressão gênica utilizou-se a extração de RNAm, síntese de cDNA e PCR real time como técnicas empregadas. Machos OTKO apresentaram redução significativa nos níveis de transcrição de AVP no HPT e aumento significativo de expressão gênica de ERb no PFC. No HPC, o grupo OTKO apresentou expressão gênica de OTR aumentada e expressão gênica de D2R e V1bR diminuídas, se comparados ao grupo WT. Por fim, para a análise de densidade e morfologia de espinhos dendríticos, lâminas de encéfalo preparadas com a técnica de Golgi foram analisadas na área CA2. Quatro grupos foram utilizados: WT (n=5) e OTKO (n=6) virgens e WT (n=5) e OTKO (n=5) com experiência sexual. Os espinhos dendríticos dos primeiros 10 μm de dendritos proximais de neurônios piramidais de CA2 foram desenhados ao longo dos diferentes planos focais em "z". Para cada macho, 2-8 dendritos diferentes foram estudados com 1 dendrito por neurônio amostrado. Os 3 principais tipos de espinhos (finos, cogumelos, largos) foram identificados e contados a partir dessas amostras. Os resultados mostram que a experiência sexual reduziu a quantidade de espinhos largos na área CA2, e o grupo OTKO sexualmente experiente apresentou menor redução destes espinhos que os animais WT. Nossos principais achados nos permitem inferir que a OT é importante para o correto desfecho do comportamento social, porém que a falta dela não altera o comportamento sexual de camundongos machos. Além disso, a ausência da OT no SNC está relacionada com uma redução nas concentrações de AVP, visto que a concentração plasmática de AVP e a expressão gênica no HPT dos OTKO apresentaram-se diminuídas. Além disso, a falta de OT interfere principalmente no HPC, onde a expressão gênica de OTR, D2R e V1bR apresentaram-se alteradas. Por fim, a experiência sexual modula os espinhos dendríticos da CA2 tanto em WT quanto em OTKO, porém esta adaptação mostrou-se menos efetiva no grupo OTKO. Palavras-chave: vasopressina, estrogênio, dopamina, córtex pré-frontal, hipotálamo. ABSTRACT The neuropeptide oxytocin (OT) modulates social behaviors, which are essential for species maintenance. Important functions related to social behaviors such as sexual motivation, social interaction, memory and emotional responses are modulated by structures of the central nervous system (CNS), such as olfactory bulb (OB), hypothalamus (HPT), prefrontal cortex (PFC) and hippocampus (HPC). OT, vasopressin (AVP), dopamine (DA) and estrogen, as well as their respective receptors (OTR, V1aR, V1bR, D2R, ERa and ERb) exert effects on these structures. Variations in the receptors and neurotransmitters are reflected in the morphology of dendritic spines and in the behavioral outcomes found in these rodents. This study aimed to analyze the impact of OT gene knockout on sexual and social interaction behaviors, in the hypothalamic synthesis of AVP and in the gene expression of OT, AVP, DA and estrogen receptors in OB, HPT, PFC and HPC. Also, we aimed to analyze the impact of OT gene knockout and sexual experience on the density and morphology of dendritic spines in the hippocampal area CA2 of male mice. C57BL / 6J mice were genotyped for the control group (WT) and for the OT knockout group (OTKO). Sexual behavior tests were performed on sexually experienced mice, composing the WT (n = 13) and OTKO (n = 12) groups. Social interaction tests used males after one week of social isolation for the WT (n = 8) and OTKO (n = 11) groups. After the behavioral tests, 6 WT and 8 OTKO mice were euthanized and blood was collected for plasma AVP analysis. Our results showed that in the social interaction test, OTKOs showed lower levels of social behaviors, lower dominance and higher levels of non-social behaviors than WT. In the ethological analysis, the OTKO group presented lower aggressive performance and greater social investigation than the WT group. No significant differences were observed in sexual behavior. On the other hand, we found lower plasma concentrations of AVP in the OTKO group compared to the WT group. For the analysis of gene expression, mice were genotyped and allocated to the WT (n = 10) and OTKO (n = 10) groups and their encephalic structures (OB, HPT, PFC and HPC) were collected. Gene expression was analyzed using mRNA extraction, cDNA synthesis and real time PCR as techniques employed. OTKO males showed a significant reduction in the levels of transcription of AVP in HPT and a significant increase of ERb gene expression in the PFC. In HPC, the OTKO group showed increased OTR gene expression and decreased D2R and V1bR gene expression, when compared to the WT group. Finally, for the analysis of density and morphology of dendritic spines, slices with brains sections prepared with the Golgi technique were analyzed in the CA2 area. Four groups were used: WT (n = 5) and OTKO (n = 6) virgin and WT (n = 5) and OTKO (n = 5) with sexual experience. The dendritic spines of the first 10 μm of proximal dendrites of CA2 pyramidal neurons were analyzed in light microscope and drawn. For each male, 2-8 different dendrites were studied with 1 dendrite per sampled neuron. The 3 main types of spines (fines, mushrooms, stubby/wide) were identified and counted from these samples. The results showed that the sexual experience was able to reduce the amount of stubby/wide spines in the CA2 area, and the sexually experienced OTKO group presented a smaller reduction of these spines than the WT animals. Our main findings allow us to infer that OT is important for the correct outcome of social behavior, but that lack of it does not alter the sexual behavior of male mice. In addition, the absence of OT in the CNS is related to a reduction in the concentrations of AVP, since the plasma concentration of AVP and the gene expression in the HPT of the OTKO were decreased. In addition, the lack of OT interferes mainly with HPC, where the gene expression of OTR, D2R and V1bR has been altered. Finally, the sexual experience modulates the dendritic spines of CA2 in both WT and OTKO, but this adaptation proved to be less effective in the OTKO group. Keywords: vasopressin, estrogen, dopamine, prefrontal cortex, hypothalamus. LISTA DE ABREVIATURAS AVP Vasopressina BNST Núcleo do leito da estrial terminal CA Corno de Amoon CoA Núcleo cortical da amigdala D1R Receptor de dopamina 1 D2R Receptor de dopamina 2 DA Dopamina ERa Receptor de estrógeno alpha ERb Receptor de estrógeno beta HPC Hipocampo HPT Hipotálamo MeA Núcleo medial da amigdala MPOA Área pré optica medial OB Bulbo olfatório OT Ocitocina OTR Receptor de ocitocina OTKO Camundongos knockout para o gene da ocitocina PFC Córtex pré-frontal PV Parvalbumina PVN Núcleo hipotalâmico paraventricular SC Via colateral de Schaffer SNC Sistema nervoso central SON Núcleo hipotalâmico supraóptico V1aR Receptor de vasopressina 1a V1bR Receptor de vasopressina 1b VMHvl Divisão ventrolateral do hipotálamo ventromedial WT Camundongos wild type SUMÁRIO 1 REVISÃO DA LITERATURA .................................................................................. 13 1.1 Introdução ................................................................................................................... 13 1.2 Ocitocina .................................................................................................................... 13 1.2.1 Receptor de Ocitocina ................................................................................................ 15 1.3 Neurotransmissores envolvidos na modulação da interação social e do comportamento sexual .............................................................................................................. 16 1.3.1 Vasopressina .............................................................................................................. 16 1.3.2 Dopamina ................................................................................................................... 17 1.3.3 Estrogênio .................................................................................................................. 18 1.4 Circuitos neurobiológicos envolvidos na modulação da interação social e do comportamento sexual .............................................................................................................. 19 1.4.1 Bulbo Olfatório .......................................................................................................... 20 1.4.2 Hipotálamo ................................................................................................................. 21 1.4.3 Córtex pré-frontal ...................................................................................................... 22 1.4.4 Hipocampo ................................................................................................................. 23 1.5 Plasticidade sináptica e espinhos dendríticos ............................................................. 27 1.6 Referências bibliográficas .......................................................................................... 29 2 JUSTIFICATIVA ....................................................................................................... 38 3 OBJETIVOS ............................................................................................................... 39 3.1 Objetivo geral ............................................................................................................. 39 3.2 Objetivos específicos .................................................................................................. 39 4 ARTIGOS ................................................................................................................... 40 4.1 ARTIGO 1: Oxytocin modulates social interaction behavior but is not essential for sexual behavior in male mice ................................................................................................... 40 4.2 ARTIGO 2: Oxytocin gene knockout alters the gene expression of oxytocin, vasopressin 1b and dopamine 2 receptors in the hippocampus of male mice .......................... 48 4.3 ARTIGO 3: Sexual experience induces spine-specific changes in CA2 pyramidal neurons of male mice ................................................................................................................ 68 5 CONCLUSÕES E CONSIDERAÇÕES FINAIS ...................................................... 86 6 ANEXO A: Pareceres de Aprovação do CEP ............................................................ 88 7 ANEXO B: Licenças para utilização de figuras ......................................................... 92 13 1 REVISÃO DA LITERATURA 1.1 Introdução A evolução molda mecanismos cognitivos e neurais, tornando-os projetados para encontrar soluções adaptativas e garantir a sobrevivência das espécies. Os padrões comportamentais de um indivíduo são oriundos da sua interação com o ambiente e com outros indivíduos (1). As respostas comportamentais ao ambiente são definidas como comportamentos não sociais (comportamento de manutenção ou de exploração), e aquelas entre indivíduos, como comportamentos sociais (2). O reconhecimento e a interação social entre os animais são habilidades cruciais para a sobrevivência e a vida em grupo (3). As ligações sociais entre os membros de um grupo possuem várias vantagens, entre elas a de garantir a defesa da espécie contra a predação. Nos mamíferos, o comportamento social de machos e fêmeas apresenta diferentes estratégias reprodutivas: o sucesso reprodutivo nos machos é determinado por competição com outros machos para se acasalar com tantas fêmeas quanto possível. Assim, os machos são tipicamente hierárquicos, com o comportamento agressivo sendo determinante para esta condição (4). Quando dois roedores machos são colocados juntos, eles engajam-se em interações sociais, que incluem vários comportamentos, dentre eles cheirar, perseguir, morder, atacar, chutar e boxear (5). Dados experimentais sugerem que as diferentes formas de interações sociais podem ser mediadas por sistemas neurais distintos e que o status de isolamento (ou não) e a familiaridade (ou não) ao ambiente em que o teste foi realizado podem interferir nos comportamentos sociais (6). Neste contexto dos comportamentos sociais, a ocitocina (OT) atua como um neurotransmissor/neuromodulador para modular diversas funções do sistema nervoso central (SNC), tanto em machos quanto em fêmeas (7–10). 1.2 Ocitocina A OT é um hormônio classicamente conhecido pela sua função no parto e na lactação, funções descobertas por Dale, em 1906. Por este fato, a palavra ―ocitocina‖ foi criada a partir da união de duas palavras gregas que significavam ―nascimento rápido‖ (11). A OT é um nonapeptídeo hidrossolúvel que possui uma ponte cys-cys nas posições 1-6, importante para o 14 reconhecimento e ligação do hormônio ao receptor. Estruturalmente assemelha-se à vasopressina (AVP), diferindo-se desse por apenas dois aminoácidos (12,13). Os genes que codificam a OT e a AVP são altamente homólogos e localizados no mesmo cromossomo, mas com orientação transcricional oposta (14). A distância entre esses genes variam de 3 a 12 kb em camundongos (15), humanos (16) e ratos (17). A OT é liberada para a circulação sanguinea e para o encéfalo. Quando este peptídeo é liberado perifericamente, sua produção ocorre nos neurônios magnocelulares do núcleo paraventricular (PVN) e do núcleo supra-óptico (SON) do hipotálamo (HPT). Os axônios de neurônios magnocelulares destes núcleos são projetados para neurohipófise, formando assim o sistema hipotálamo-neurohipofiseal (18). Já a OT liberada para o SNC é produzida, em menores quantidades, nos neurônios parvocelulares do PVN e, dependendo da espécie, no núcleo do leito da estria terminal (BNST), na área pré-óptica medial (MPOA) e amígdala lateral (14). Em roedores, os neurônios ocitocinérgicos da região parvocelular do PVN projetam-se para várias áreas cerebrais, dentre elas: núcleo hipotalâmico dorsomedial, núcleos talâmicos, hipocampo (HPC), subículo, cortex entorrinal, núcleos septais lateral e medial, amígdala, bulbo olfatório (OB), substância negra, locus ceruleus, núcleo da rafe, núcleo do trato solitário (11, 19). Muitos estudos têm acumulado evidências de que, além das funções hormonais clássicas, a OT e a AVP desempenham papéis críticos nos comportamentos sociais em mamíferos (2,20,21). A OT possui importante papel nas interações sociais, como no comportamento maternal (22) e no agressivo maternal (7,9). Engelmann et al. (2000) sugerem que a OT também pode ser liberada durante a escolha e a formação de pares sexuais e que este peptídeo, associado à AVP, pode agir influenciando comportamentos relacionados ao estresse, ao aprendizado e a memória (23). A OT facilita a motivação social, o comportamento de aproximação e, também, parece ser fundamental em processos de memória social no que se refere à discriminação de indivíduos familiares ou não (24). Estudos realizados com camundongos nocautes para o gene da OT (OTKO) mostraram que esta é essencial para o reconhecimento social e pode influenciar a aquisição de memória (25–27). Ferguson et al. (2001) demonstraram que animais OTKO são incapazes de reconhecer entre indivíduos conhecidos e desconhecidos em testes de habituação- desabituação, e que o tratamento de reposição de OT na amigdala medial (MeA) restaura completamente o reconhecimento social destes animais (28). Um estudo anterior do nosso laboratório (29) analisou os comportamentos de investigação social e comportamento agressivo em camundongos machos OTKO por meio do 15 teste de interação social. Este estudo demonstrou que machos OTKO apresentam uma frequência aumentada de investigação oronasal e anogenital em comparação com o tipo selvagem (WT). Por outro lado, o grupo OTKO demonstrou um desempenho agressivo menor do que o grupo WT, comprovando a importância deste peptídeo para o comportamento hierárquico social. No que se refere ao comportamento sexual, machos OTKO não apresentaram alterações comportamentais e fêmeas OTKO apresentam comportamento sexual diminuído (29,30). 1.2.1 Receptor de Ocitocina Somente um tipo de receptor para OT é reconhecido e clonado (13). Este receptor está amplamente distribuído no encéfalo, variando a localização de acordo com a espécie e o gênero. O receptor de ocitocina (OTR) pertence à família dos receptores heterotriméricos acoplados à proteína G, sendo expresso por diversos tipos de células, incluindo neurônios, células ósseas, mioblastos, cardiomiócitos e células endoteliais (19). Ele pode estar associado tanto a proteínas G do tipo Gq/11 como as proteínas Gi, e seus efeitos intracelulares dependem do tipo de acoplamento (31,32). Receptores associados à proteína Gq/11 possuem caráter excitatório e receptores associados à proteína Gi têm caráter inibitório (33). As diferentes expressões do OTR no encéfalo podem explicar as variações comportamentais (como a monogamia ou poligamia) observadas em diferentes subespécies de roedores (34). Diferentes vias de transdução de sinais regulam a expressão do OTR e a ligação em cada região cerebral e podem, em parte, mediar a habilidade da OT para exercer diversos efeitos comportamentais (35). Em roedores, a distribuição de OTR ocorre principalmente no OB, núcleos basais, córtex piriforme, córtex insular e perirrinal, formação hipocampal, amígdala central, BNSP lateral e medial, septo lateral, núcleo accumbens e HPT ventromedial, núcleo do trato solitário e área tegmental ventral, complexo mamilar, núcleo olivar dorsal, núcleo espinal trigeminal, colículo superior do tronco encefálico e medula espinal (34,36–38). Mitre et al (2016) quantificaram os níveis de expressão de OTR em 29 regiões cerebrais, escolhidas com base na sua importância no comportamento social. As regiões incluíram HPT, regiões neocorticais como o córtex piriforme e auditivo, amígdala, sub- regiões do HPC, córtex frontal, OB e núcleo mediano da rafe. As análises foram feitas em camundongos machos e fêmeas virgens e fêmeas mães e detectaram que as mães apresentam níveis de OTR maiores que os padrões encontrados em camundongos virgens (39). 16 A análise microscópica eletrônica revelou que os OTR estavam localizados em sinapses excitatórias e inibitórias (pré e pós-sinapticamente), ao longo de axônios e expressos por células gliais. O efeito predominante da modulação da OT via OTR, foi de reduzir a transmissão inibitória sem afetar diretamente a excitação. Assim, os autores sugeriram que a modulação da inibição pudesse ser um mecanismo geral pelo qual a OT pode atuar em todo o encéfalo para regular os comportamentos parentais e a cognição social (39). A expressão dos OTR em células gliais é um dado interessante que traz outras possibilidades de modulação à liberação de OT. O fato de a glia apresentar OTRs, pode permitir que estas células detectem os níveis de OT no SNC ou no sangue, possibilitando que elas regulem a libertação de OT e de outros neurohormônios (40,41). 1.3 Neurotransmissores envolvidos na modulação da interação social e do comportamento sexual 1.3.1 Vasopressina Além de muitos estudos relacionando comportamento social e OT, não podemos ignorar que uma série de neurotransmissores e neuropeptídeos têm sido relacionados aos elementos neurobiológicos da cognição social (42,43). Junto com a OT, o peptídeo mais estreitamente relacionado com comportamentos sociais é a AVP (44). As ações da AVP sobre o comportamento social são mediadas por dois subtipos de receptores específicos: receptor de AVP 1a (V1aR) e receptor de AVP 1b (V1bR) (45). Enquanto V1aR é expresso em várias áreas cerebrais (OB, amígdala, córtex piriforme, HPT, órgão vomeronasal, subículo do ventrículo, área tegmental ventral) (4), os V1bR de camundongos, ratos e seres humanos estão mais discretamente localizados, com proeminência em células piramidais da região CA2 do HPC e em algumas células dentro da amígdala anterior e PVN (Para uma revisão, ver (45)). Sabe-se que os camundongos machos nocautes para V1aR apresentam uma completa interrupção no reconhecimento social, sem apresentarem prejuízos na aprendizagem não- social e em tarefas de memória. Isto sugere que as ações de AVP via V1aR são específicas no reconhecimento de odores sociais (46). Já trabalhos prévios com camundongos nocautes V1bR, relacionaram a falta de V1bR com déficit significativo de reconhecimento social e memória social, déficit de motivação para interagir com estímulos sociais e deficiências no comportamento agressivo em contextos sociais específicos (45,47). 17 Além do papel da AVP no comportamento social, estudos têm descrito a importância das projeções vasopressinérgicas em relação ao comportamento sexual (22). Uma das estruturas que parece estar envolvida no controle do comportamento sexual masculino é o BNST, pois os machos têm mais neurônios AVP e projeções mais densas nessa área e no núcleo amidaloide medial do que as fêmeas (48). A AVP influencia a reprodução e o comportamento do macho e está envolvida na ereção e ejaculação em várias espécies, incluindo ratos e coelhos (49); a AVP também medeia uma variedade de comportamentos sociais típicos masculinos, incluindo agressão e territorialidade em várias espécies (50). Além disso, como a cópula libera OT e AVP, uma possibilidade é que estes neuropeptídeos estejam envolvidos no processo de formação de pares após o acasalamento (51). Estudos prévios demonstraram que a administração de AVP estimula os comportamentos associados à monogamia, tais como cuidados paternos, guarda de companheiros e uma preferência seletiva para o companheiro em ratos de pradaria. Tratamento semelhante não induz estes comportamentos em espécies não monogâmicas [para revisão, ver (50)], provavelmente pelo fato de que distribuição de receptores de AVP entre essas espécies é tão divergente quanto seu comportamento social. O simples aumento da expressão do receptor V1aR dentro do circuito de recompensa no encéfalo de ratos da montanha permite que indivíduos desta espécie não monogâmica formem uma preferência seletiva pelo seu companheiro, indicando que os padrões de V1aR influenciam o repertório sócio comportamental de uma espécie (52,53). 1.3.2 Dopamina A existência de interação positiva entre dopamina (DA) e OT no comportamento social, em distúrbios associados como autismo, disfunção sexual, dependência e depressão tem sido mais discutida atualmente (54). Modelos animais parecem indicar a existência de circuitos cerebrais amplos e integrados onde as interações DA e OT, pelo menos em parte, medeiam comportamentos sociais. Tanto OT como DA desempenham um papel dentro do OB no reconhecimento social; no entanto, a DA, especialmente através dos receptores do tipo 2 de DA (D2R), desempenha um papel mais proeminente na consolidação da memória do que no reconhecimento em si (51). Em ratas da pradaria o bloqueio de D2R antes do teste de preferência pelo parceiro não interfere no reconhecimento do parceiro em si, mas o bloqueio deste logo após o 18 acasalamento inibe a consolidação da memória de reconhecimento do parceiro (55). Em machos da pradaria, a ativação DA via D2R no núcleo acumbens é crítica para a formação de pares, já a ativação dos receptores tipo 1 (D1R) impede as preferências dos parceiros por seus pares (56). Em um trabalho recente, Rocchetti el al. (2015) descobriram que a deleção de D2R diminui severamente o desempenho de ratos em tarefas de aprendizagem e de memória e prejudica a plasticidade sináptica na região CA1 do HPC (57). A expressão pós-sináptica D2R é restrita ao giro denteado, onde estes ativam vias de sinalização múltipla (58). Já as fibras dopaminérgicas portadoras de D2R pré-sinápticos inervaram as áreas temporais de CA1 (57), onde exercem um controle inibitório sobre a síntese e liberação de DA (59). As conexões entre DA e OT também estão envolvidas nas interações sócio sexuais. No acasalamento, as conexões de DA e OT estão envolvidas tanto na ereção do pênis quanto nos comportamentos subsequentes relacionados com a recompensa do comportamento sexual (54). Durante a excitação sexual, a estimulação do sistema mesolímbico de DA, envolvido nos efeitos motivacionais da atividade sexual, ocorre via OT. A OT liberada na área tegmental ventral, subículo ventral e amígdala, ativa neurônios DA mesolímbicos, culminando na ativação das vias de recompensa (60). Já durante o acasalamento, a liberação de OT na amigdala, HPC e área tegmental ventral facilita o aprendizado e a memória social e estimula as projeções de recompensa dopaminérgicas mesolímbicas, que projetam-se para a núcleo acumbens e PFC. A DA no núcleo acumbens pode ser ativada para modular a ligação de pares (54). 1.3.3 Estrogênio Além das funções clássicas descritas para o estrogênio, outro papel para este hormônio está surgindo neste contexto. A regulação estrogênica de diversos comportamentos sociais tem sido investigada em camundongos nocautes para os receptores de estrogênio alfa (ERa) e beta (ERb). Machos nocautes para ERa e ERb mostraram fenótipos comportamentais opostos quando testados para o comportamento agressivo: enquanto os nocautes ERa apresentaram menor comportamento agressivo (61), os nocautes ERb são mais agressivos do que seus respectivos controles (27). Já em testes de reconhecimento e memória, machos nocautes para o ERa mostraram reconhecimento normal, mas retenção de memória de discriminação social prejudicada. Os nocautes ERb não mostraram qualquer prejuízo no reconhecimento social em qualquer dos testes [para uma revisão, ver (42)]. 19 Embora, Choleris et al. (2012) sugira que os receptores de estrogênio parecem facilitar as ações da OT com relação ao reconhecimento social (42), ainda não existe um concenso sobre o mecanismo exato da ação do estrogênio no comportamento social. Neste trabalho, os autores propõem que esta ação regularia genes ou sistemas de neurotransmissores que estão implicados na aprendizagem social. Estes sistemas incluem: OT, DA, peptídeos opióides, acetilcolina, fatores neurotróficos e progesterona. Um exemplo desta ação modulatória ocorre na amígdala medial, onde ERa induz a transcrição do gene de OTR e no HPT, onde a síntese de OT é modulada pela ativação de Erb (42). Assim, qualquer desbalanço em ERa ou ERb pode resultar em modificações sobre a síntese ou a ação de OT e desta forma, alterar os comportamentos sociais (62). 1.4 Circuitos neurobiológicos envolvidos na modulação da interação social e do comportamento sexual FIGURA 1 Neuromodulação dos circuitos comportamentais pela OT e AVP: Regiões expressando receptores para OT (em vermelho) e para AVP (em verde) no encéfalo de roedores e suas respectivas conexões. (a) PFC medial, mostrando a expressão de OTR 20 (vermelho) em neurônios que regulam a liberação de glutamato (azul). A OT atua ativando receptores pré-sinápticos canabinoides CB1 (roxo). (b, c, e) OTRs (vermelho) expressos em neurônios do núcleo accumbens, amigdala medial e medula espinal. (d) O hipocampo, que expressa os receptores de OT e AVP em diferentes níveis: na região CA3, OT afeta o potencial de equilíbrio, em CA2 onde os agonistas de OT e V1b R melhoram a transmissão sináptica glutamatérgica e na região CA1 onde OTRs afetam a transmissão excitatória em neurônios piramidais. Fonte: http://www.sciencedirect.com/science/article/pii/S0959438814002001 Número de licença para utilização: 4077761049710 (Anexo B) 1.4.1 Bulbo Olfatório A olfação em roedores envolve dois órgãos sensoriais: o OB principal, que está envolvido no olfato geral, e o órgão vomeronasal. Acredita-se que o reconhecimento individual envolva a detecção de feromônios pelo órgão vomeronasal, que projeta-se para o OB acessório e depois para MeA e núcleo cortical da amígdala (CoA) (63). O OB acessório, MeA e CoA são particularmente ricos em receptores de OT e são, portanto, locais candidatos para a ação da OT na formação de memória social em camundongos (4). Dentro de uma mesma espécie, a formação de pares sociais e os comportamentos reprodutivos, dependem da capacidade de reconhecer indivíduos familiares ou não-familiares (para revisão, ver (21)). Em roedores, o OB principal e o acessório são ativados nos encontros sociais e são cruciais para este reconhecimento, sendo o OB acessório o responsável por detectar os feromônios, transmitindo a informação para iniciar um comportamento específico ou respostas endócrinas (64,65). Ratos de pradaria servem como um excelente modelo para o estudo do comportamento sexual e das funções neuroendócrinas relacionadas (56). Quando ratos da pradaria não familiarizados se encontram, eles se envolvem em repetidas investigações olfatórias da região genital do parceiro, seguidas por períodos prolongados de grooming. Durante esse tempo, os feromônios urinários do macho, administrados ao epitélio olfatório da fêmea, ativam diretamente múltiplos processos neuroendócrinos e induzem a fêmea a seu primeiro estro. Dentro de 48 h a fêmea é sexualmente receptiva e libera seus feromônios para se engajar em repetidas interações copulatórias com o macho, que responde ao estímulo sexual realizando as montas (66). Embora o OB não possua terminais ocitocinérgicos, ele apresenta OTR em abundância. Este desajuste de terminais com receptores é funcionalmente abordado pela 21 liberação neurohumoral de OT no fluido cerebrospinal, em situações como o parto e o acasalamento (4,67). Estes eventos biológicos produzem mudanças significativas na sensibilidade, eficácia sináptica e ativação neural no OB, que fazem parte do processo de aprendizagem olfativa para a familiaridade social (65,68). 1.4.2 Hipotálamo O HPT é a região responsável por adicionar o componente endócrino aos mecanismos comportamentais, uma vez que os efeitos dos hormônios sexuais nas propriedades eletrofisiológicas dos neurônios, a transcrição do RNAm e a síntese de novas proteínas e neuropeptídios como a OT e a AVP, são primariamente mediados pelo HPT (69). Décadas de estudos envolvendo lesão e estimulação identificaram o HPT como um centro responsável pelo controle da agressão em machos [para revisão, ver (70)]. Em gatos, bem como em roedores, este estudos comprovaram que o HPT era crítico para o comportamento de ataque (71,72). Um estudo de Lin et al. (2011) descreveu a divisão ventrolateral do HPT ventromedial (VMHvl) e o comportamento agressivo de camundongos machos (73). Por outro lado, Scott et al. (2015) demonstraram que neurônios do núcleo periventricular anteroventral do HPT que expressam tirosina hidroxilase projetam diretamente para neurônios OT no PVN e, quando estimulados, aumentam a liberação de OT na circulação (74). Um estudo de Yang et al. (2013) identificou que o silenciamento do receptor para progesterona no VMHvl levou à redução significativa na agressão, bem como déficits específicos no comportamento sexual dos machos (75). No entanto, os machos com este silenciamento de VMHvl ainda conseguiam distinguir entre os sexos e também marcar seu território, indicando que os déficits comportamentais no acasalamento e na agressão não representavam déficits generalizados nos comportamentos sociais (75). Um estudo relacionado (76) demonstrou que a estimulação de uma população sobreposta de neurônios na VMHvl e que expressa ERa provocou manifestações sexuais dos machos em relação tanto aos camundongos fêmeas quanto aos machos, enquanto a estimulação mais forte gerou ataques direcionados a ambos os sexos. A área cerebral mais sensível para a indução da ereção peniana pela OT é o PVN, a OT injetada nesta área é capaz de induzir a ereção peniana em doses tão baixas quanto 3 pmol (60). Quanto ao mecanismo pelo qual a OT atua no PVN para induzir essa resposta sexual, estudos sugerem que a OT ativa os seus próprios neurônios; de acordo com essa hipótese, a 22 interação sexual aumenta a expressão do c-Fos em neurônios ocitocinérgicos do PVN que se projetam para medula espinal e estão envolvidos no controle da ereção peniana (60,77). Além dos papeis já bem descritos do HPT em relação aos comportamentos agressivo e sexual, sabe- se que a infusão de OT em MPOA de ratos melhora o comportamento de reconhecimento social (3). 1.4.3 Córtex pré-frontal Segundo Fuster (2001), o PFC não se encontra envolvido exclusivamente em processos cognitivos, pois a região órbito-frontal está relacionada com aspectos emocionais do comportamento, além do controle inibitório. Já o PFC medial é uma região envolvida na tomada de decisões, na flexibilidade comportamental, além de ser mediador potencial de inibição comportamental (78). O PFC medial contém neurônios sensíveis a OT, expressa em abundância OTRs e recebe projeções axonais de longo alcance de OT produzida no HPT (34). Na camada V do PFC medial, a OT suprime a neurotransmissão glutamatérgica em neurônios piramidais através de uma ativação pré-sináptica de receptores canabinoides CB1 (Figura 1a). Em vista das projeções do PFC para neurônios inibitórios na amigdala central, é possível que esses efeitos de OT trabalhem em conjunto com os efeitos excitatórios de OT na CeA em neurônios inibitórios (79). Davis et al. (2010), testaram o papel do PFC medial na inibição do comportamento sexual quando associada a resultados aversivos. Os pesquisadores descobriram que as lesões do PFC medial resultam em um comportamento sexual compulsivo, independente se este foi associado com recompensa ou estímulos aversivos. Estes animais provavelmente eram incapazes de suprimir a busca de recompensa sexual em face de consequências aversivas. Estes dados sugerem um papel do PFC medial na regulação da busca compulsiva de recompensa (80). As alterações diretas do equilíbrio excitação/inibição dentro do PFC em camundongos adultos têm um forte efeito sobre a motivação social [para uma revisão, ver (81)]. Yizhar et al. (2011) utilizaram a optogenética para manipular de forma independente a atividade de neurônios piramidais excitatórios e interneurônios inibitórios de parvalbumina (PV) do PFC durante uma tarefa de exploração social e no teste de sociabilidade. Eles descobriram que, estimulando neurônios piramidais no PFC, a exploração social foi abolida e a preferência social foi comprometida. Os efeitos de uma excitação aumentada foram melhorados ao estimular simultaneamente os interneurônios PV, mostrando que uma razão excitação/inibição 23 apropriada no PFC é necessária para a motivação social em camundongos (82). O aumento da razão excitação/inibição no PFC leva também a déficits no reconhecimento social, já a retenção de memórias sociais é aumentada ativando interneurônios inibitórios (83). Um estudo recente examinou a atividade cerebral total através a expressão da Fos num contexto social e, descobriu que o PFC de camundongos foi ativado na interação social (84). Em camundongos, a dominância também parece estar ligada ao microcircuito no PFC. Wang et al. (2011) observaram que alterar a eficácia da transmissão sináptica no PFC provoca uma modulação bidirecional da hierarquia social (85). Especificamente, o aumento da excitabilidade aumenta a posição do camundongo dentro da hierarquia e atenuar a eficácia da transmissão sináptica diminui sua classificação. Por outro lado, a ativação optogenética do PFC medial em camundongos diminui o comportamento agressivo, enquanto silenciar esta região leva a uma escalada de agressão (86). Esse achado é interessante à luz dos achados de Wang et al., porque esses estudos juntos demonstram uma regulação contrária da agressão e da dominância pela atividade de PFC (81). 1.4.4 Hipocampo O HPC faz parte do sistema límbico, o qual participa do processamento de respostas adequadas ao contexto em que o animal está inserido, baseado em aprendizados anteriores. Indicações químicas, tais como odor, medeiam interações sexuais e competitivas e são importantes no reconhecimento e seleção de pares (87–89). Os odores são processados por vias olfatórias e vomeronasais, que projetam-se diretas e indiretas para o MeA (67) com uma entrada relativamente menor para o BNST (44). O MeA envia grandes projeções para o BNST e MPOA, que por sua vez projetam para o septo lateral e HPC, responsável pelo processamento da memória social (30,44). O HPC propriamente dito consiste na região de Cornu Ammonis (CA), denominação em latim para Corno de Ammon, que se trata de uma tira de neurônios piramidais e pelo giro dentado, que consiste em células granulares. A CA e o giro denteado estão dispostas anatomicamente numa estrutura enrolada, que constitui a formação hipocampal (90). A formação hipocampal de mamíferos é essencial para a aprendizagem e memória, exerce importantes funções relacionadas à conversão da memória de curto prazo em memória de longo prazo, na orientação espacial, no processamento do medo, na regulação da resposta ao estresse e nos comportamentos sociais (90). 24 Os primeiros neuroanatomistas descreveram duas áreas distintas do CA em encéfalos de roedores: a porção superior, que consistia em pequenos neurônios piramidais (regio superior de Cajal) e a porção inferior, que consistia de neurônios piramidais maiores (regio inferior de Cajal). No entanto, em 1934, Rafael Lorente de Nó notou que uma pequena área do regio inferior era suficientemente distinta em sua citoarquitetura e conectividade para justificar uma nomenclatura separada. Por essa razão, ele designou três áreas CA contendo neurónios piramidais como CA1, CA2 e CA3 (91). Lorente de Nó observou que os corpos celulares piramidais do CA2, como os do CA3, são maiores que os encontrados no CA1. No entanto, observou que os dendritos de células piramidais CA2 não possuem as excrescências espinais especializadas associadas à entrada de fibras musgosas do giro denteado, que são características dos neurônios piramidais CA3 (90). A região CA1 do hipocampo recebe potente entrada excitatória de CA3 através da via colateral de Schaffer (SC). A ativação de axônios SC evoca um potencial pós-sináptico excitatório monossináptico sobre as células piramidais de CA1, assim como excita uma variedade de interneurônios CA1. Estes interneurônios, em seguida, entregam um potencial pós-sináptico inibitório um milissegundo atrasado, causando uma inibição direta. Deste modo, tanto o limiar de estimulação como o tempo de picos evocados nas células piramidais CA1 por ativação de SC são ditados por um balanço finamente sintonizado de entradas monossinápticas excitadoras e dissinápticas inibitórias (92,93). No trabalho de Owen et al. (2013), demonstrou-se que a ação da OT neste contexto ocorre especificamente em interneurônios de disparo rápido e pode ser orientada para alterar a função de rede através de um ajuste fino da inibição de fundo. Através da utilização de um agonista para OTR, o aumento da atividade de interneurônios de disparo rápido não apenas suprime a ativação espontânea de células piramidais, mas também melhora a fidelidade da transmissão sináptica e agudiza o sincronismo dos picos (Figura 1d) (93). Os interneurônios de disparo rápido estimulados pela OT são fisiológica e funcionalmente distintos dos interneurônios regulares, que desempenham um papel importante na inibição e cuja produção é regulada por endocanabinoides (94). Nesta segmentação seletiva de populações de interneurônios, neuromoduladores como a OT e endocanabinóides podem ser especializados para esculpir diferentes formas de inibição (93). Apesar de as ações da OT terem sido elucidadas em experimentos envolvendo CA1, sabe-se que a área CA2 também é rica em interneurônios inibitórios. Porém, estudos apontam que os interneurônios de CA2 podem possuir um funcionamento diferente daqueles interneurônios das áreas vizinhas CA1 e CA3 (90). 25 1.4.4.1 Região CA2 do hipocampo A região CA2 foi descrita em 1934, mas pouco se soube sobre sua função até recentemente, como se esta região houvesse sido negligenciada do circuito hipocampal até então, talvez devido à sua pequena área em comparação com as outras subdivisões hipocampais (95,96). Atualmente, a área CA2 atraiu o interesse dos pesquisadores, pois em comparação com os neurônios de CA1 e CA3, os neurônios em CA2 são relativamente resistentes aos danos que surgem durante o curso de várias doenças, incluindo epilepsia, hipóxia, desordens vasulares e esquizofrenia (97,98). Além destes achados, descobriu-se que, aliado à resistência aumentada a danos, os neurônios de CA2 também apresentam resistência à plasticidade sináptica, quando comparados às outras regiões do HPC (99). Estas peculiaridades da região CA2 intrigaram pesquisadores das mais diversas áreas e, recentemente, esta região tem sido mais estudada. Estudos anatômicos, de expressão gênica, de influências neuromoduladores, de vias de sinalização celular e de eletrofisiologia vêm demonstrando as propriedades desta área (96,100). As principais aferências para CA2 são: neurônios vasopressinérgicos do PVN, o núcleo supramamilar, a rafe medial, o septo medial e diagonal, o córtex entorrinal, o giro denteado e CA3. Já o principal alvo das eferências da área CA2 é o CA1. Os neurônios piramidais CA2 projetam principalmente para a área stratum oriens, coberta pelos dendritos basais de neurônios piramidais CA1. As projeções do CA2 a CA1 tem uma vasta extensão caudal ao longo do eixo longitudinal do HPC de ratos e podem servir para integrar a informação do HPC dorsal com as das regiões mais ventrais. Além das projeções para CA1, os axônios dos neurônios piramidais CA2 ramificam-se fortemente dentro de CA2 e CA3, proporcionando assim um elevado grau de interconexão local e recursiva. Projeções de CA2 que saem do HPC incluem axônios que formam conexões recíprocas de volta aos núcleos supramamilar, septal e córtex entorrinal (para uma revisão, ver (90)) (Figura 2). 26 FIGURA 2 Conectividade de neurônios piramidais de CA2 dentro do circuito hipocampal de roedores: Neurônios do giro denteado (DG neuron); neurônios da camada II do córtex entorrinal (EC LII neuron); stratum oriens (SO); stratum pyramidale (SP); stratum lucidum (SL); stratum radiatum (SR); stratum lacunosum-moleculare (SLM). As entradas extra-hipocampais para CA2 (indicadas por setas pretas) incluem as de neurônios vasopressinérgicos do PVN e da rafe mediana (MRa) e conexões recíprocas com o núcleo supramammilar (SuM) septo mediano (MS) e feixe diagonal de Broca (DBBs). Fonte: http://www.nature.com/nrn/journal/v17/n2/abs/nrn.2015.22.html Número de licença para utilização: 4077760641180 (Anexo B) Várias classes funcionais de proteínas são particularmente expressas em CA2. Muitas destas proteínas são preditas como tendo papéis tanto na limitação da plasticidade como na limitação dos danos dos processos patológicos (90). Entretanto, uma questão interessante é que neurônios piramidais CA2 expressam altos níveis de receptores para os neuropeptídeos envolvidos em comportamentos sociais AVP e OT (11,101), evidência sugestiva de um papel específico para CA2 neste contexto. O trabalho de Hitti & Siegelbaum (2014) (100) comprovou que o silenciamento neuronal de CA2 resultou em um comprometimento seletivo da memória de reconhecimento social dos camundongos. Por outro lado, o silenciamento de CA2 não prejudicou outras 27 tarefas de memória dependentes do HPC, tais como o reconhecimento de novos objetos ou a memória espacial. Especificamente, os camundongos foram incapazes de diferenciar entre camundongos novos e familiares, o que demonstra que a transmissão sináptica a partir de neurônios piramidais CA2 é essencial para a codificação de informação social em memórias. No entanto, ainda não está claro como os neurônios CA2 integram o processamento social com outros aspectos da memória episódica, como o tempo e o espaço. Um estudo recente de Pagani et al. (2015) propôs que AVP e OT diminuem drasticamente o limiar para a estimulação em neurônios piramidais de CA2 (Figura 1d). Segundo os autores, a AVP, via ativação de V1bR, aumenta a potencialização sináptica levando à associação de circunstâncias sociais (tais como o contexto espacial e o comportamento do outro camundongo) com odores específicos (96). Desta forma, além de participar de circuitos do HPC subjacentes ao processamento espacial, a área CA2 é crucial para a consolidação de informações socialmente relevantes na memória de longo prazo e também pode desempenhar um papel na codificação temporal (90). 1.5 Plasticidade sináptica e espinhos dendríticos Os espinhos dendríticos são pequenas protrusões dos ramos dendríticos de vários tipos de neurônios, incluindo os neurônios piramidais do neocórtex, os neurônios medianos do estriado e as células de Purkinje do cerebelo (102). A distribuição, a forma e o tamanho dos espinhos dendríticos estão diretamente relacionados com a função do neurônio, portanto, a determinação do número de espinhos por segmento dendrítico ou densidade por micrômetro (µm) dendrítico pode ajudar a elucidar a atividade celular local e sua plasticidade (103). Espinhos dendríticos têm propriedades cruciais para a força sináptica e plasticidade e afetam a atividade neuronal em circuitos integrados (30,104). Uma característica peculiar dos espinhos dendríticos é a sua variabilidade morfológica. Esta característica é um reflexo do rearranjo rápido dos filamentos de actina no seu interior, o que pode levar à mudança no tamanho e no número de espinhos (102). Em geral, os espinhos dendríticos podem ser classificados de acordo com a sua morfologia com a seguinte nomenclatura: filopódio, que não apresenta uma cabeça definida, sendo fino e comprido, e acredita-se que seja a forma precursora dos espinhos; fino, o qual apresenta pescoço fino e pode não ter uma cabeça bem definida; espesso, que não apresenta um pescoço diferenciado e representa apenas uma elevação no contorno dendrítico; cogumelo, que apresenta o pescoço fino e uma cabeça grande, parecendo ser o mais estável em termos de 28 contatos sinápticos duradouros e ramificado, no qual o pescoço pode dar origem a mais de uma cabeça (102,105,106). Tipicamente, as cabeças de espinhos dendríticos formam sinapses excitatórias assimétricas com um axônio pré-sináptico (102). A morfologia dos espinhos dendríticos afeta a difusão e a compartimentação das proteínas associadas à membrana e a expressão dos receptores AMPA (106). Sabe-se, por exemplo, que espinhos com morfologia do tipo cogumelo apresentam mais receptores AMPA em comparação com espinhos finos (102). Sendo assim, os espinhos dendríticos mais longos (finos) têm uma menor densidade de receptores de glutamato pós-sinápticos e respondem ao glutamato com uma corrente interna menor registrada no soma do que os espinhos mais curtos. Portanto, as maiores respostas são observadas com sinapses de espinhos espessos (104). 1.6 Camundongo Nocaute para o gene da ocitocina Os avanços da genômica, a conclusão do mapeamento do genoma humano, a busca pela cura através da fabricação de novos medicamentos resultaram no aumento de pesquisas com modelos geneticamente modificados. A técnica foi desenvolvida no final da década de 1970 em camundongos, o mamífero cujo genoma é, até hoje, o mais facilmente manipulável. Atualmente, a transgenia permite tanto a transferência de DNA exógeno para o animal, através da técnica de microinjeção pronuclear, quanto à alteração de DNA já existente no animal, através da recombinação homóloga em células-tronco embrionárias (107). A criação dos camundongos OTKO é de responsabilidade de três grupos de pesquisadores. Nishimori et al. (1996) (108) deletaram o primeiro éxon, Young et al. (1996) (109) deletaram um segmento do segundo éxon e Gross et al. (1998) (110) deletaram os três éxons da OT. O modelo de experimentação utilizando animais nocaute permite avaliar o papel da OT em relação a diversos parâmetros de interesse do pesquisador, tais como: neuroendócrino, fisiológico, comportamental, entre outros. 29 1.6 Referências bibliográficas 1. Barbey AK, Krueger F, Grafman J. An Evolutionarily Adaptive Neural Architecture for Social Reasoning. Trends Neurosci. 2009;32(12):603–10. 2. Insel TR, Fernald RD. How the brain processes social information: Searching for the Social Brain. Annu Rev Neurosci. 2004;27(1):697–722. 3. Choleris E, Clipperton-Allen AE, Phan A, Kavaliers M. Neuroendocrinology of social information processing in rats and mice. Front Neuroendocrinol. 2009;30(4):442–59. 4. Keverne EB, Curley JP. Vasopressin, oxytocin and social behaviour. Curr Opin Neurobiol. 2004;14(6):777–83. 5. Patin V, Lordi B, Vincent A, Caston J. Effects of prenatal stress on anxiety and social interactions in adult rats. Dev Brain Res. 2005;160(2):265–74. 6. Varlinskaya EI, Spear LP. Social interactions in adolescent and adult Sprague-Dawley rats: Impact of social deprivation and test context familiarity. Behav Brain Res. 2008;188(2):398–405. 7. Giovenardi M, Padoin MJ, Cadore LP, Lucion AB. Hypothalamic Paraventricular Nucleus Modulates Maternal Aggression in Rats : Effects of Ibotenic Acid Lesion and Oxytocin Antisense 1. 1998;63(3):351–9. 8. Engelmann M, Landgraf R. Microdialysis Administration of Vasopressin Into the Septum Improves Social Recognition in Brattleboro Rats. Physiol Behav. 1994;55:145–9. 9. Amico J a, Mantella RC, Vollmer RR, Li X. Anxiety and stress responses in female oxytocin deficient mice. J Neuroendocrinol. 2004;16(4):319–24. 10. Carter CS, Boone EM, Pournajafi-Nazarloo H, Bales KL. Consequences of early experiences and exposure to oxytocin and vasopressin are sexually dimorphic. Dev Neurosci. 2009;31(4):332–41. 11. Lee HJ, Macbeth AH, Pagani JH, Scott Young W. Oxytocin: The great facilitator of life. Prog Neurobiol. 2009;88(2):127–51. 12. Acher R, Chauvet J, Chauvet MT. Man and the chimaera. Selective versus neutral oxytocin evolution. Adv Exp Med Biol. 1995;395:615–27. 13. Caldwell H, Iii WY. Oxytocin and Vasopressin: Genetics and Behavioral Implications. Handb Neurochem Mol Neurobiol. 2006;573–607. 14. Young WS, Gainer H. Transgenesis and the study of expression, cellular targeting and 30 function of oxytocin, vasopressin and their receptors. Vol. 78, Neuroendocrinology. 2003. p. 185–203. 15. Hara Y, Battey J, Gainer H. Structure of mouse vasopressin and oxytocin genes. Mol Brain Res. 1990;8(4):319–24. 16. Sausville E, Carney D, Battey J. The human vasopressin gene is linked to the oxytocin gene and is selectively expressed in a cultured lung cancer cell line. J Biol Chem. 1985;260(18):10236–41. 17. Mohr E, Schmitz E, Richter D. A single rat genomic DNA fragment encodes both the oxytocin and vasopressin genes separated by 11 kilobases and oriented in opposite transcriptional directions. Biochimie. 1988;70(5):649–54. 18. Oliet SHR, Piet R. Anatomical remodelling of the supraoptic nucleus: Changes in synaptic and extrasynaptic transmission. J Neuroendocrinol. 2004;16(4):303–7. 19. Gimpl G, Fahrenholz F, Gene C. The Oxytocin Receptor System: Structure, Function, and Regulation. Physiol Rev. 2001;81(2):629–83. 20. Neumann ID. Brain oxytocin: A key regulator of emotional and social behaviours in both females and males. J Neuroendocrinol. 2008;20(6):858–65. 21. Ferguson JN, Young LJ, Insel TR. The neuroendocrine basis of social recognition. Front Neuroendocr. 2002;23(2):200–24. 22. Zimmermann-Peruzatto JM, Lazzari VM, de Moura AC, Almeida S, Giovenardi M. Examining the role of vasopressin in the modulation of parental and sexual behaviors. Front Psychiatry. 2016. 23. Engelmann M, Wotjak CT, Ebner K, Landgraf R. Behavioural impact of intraseptally released vasopressin and oxytocin in rats. Exp Physiol. 2000;85 Spec No:125S–130S. 24. Lim MM, Young LJ. Neuropeptidergic regulation of affiliative behavior and social bonding in animals. Horm Behav. 2006;50(4):506–17. 25. Ferguson JN, Young LJ, Hearn EF, Matzuk MM, Insel TR, Winslow JT. Social amnesia in mice lacking the oxytocin gene. Nat Genet. 2000;25(3):284–8. 26. Winslow JT, Insel TR. The social deficits of the oxytocin knockout mouse. Neuropeptides. 2002;36(2–3):221–9. 27. Choleris E, Gustafsson J-Å, Korach KS, Muglia LJ, Pfaff DW, Ogawa S. An estrogen- dependent four-gene micronet regulating social recognition: a study with oxytocin and estrogen receptor-alpha and -beta knockout mice. Proc Natl Acad Sci U S A. 2003;100(10):6192–7. 28. Ferguson JN, Aldag JM, Insel TR, Young LJ. Oxytocin in the Medial Amygdala is 31 Essential for Social Recognition in the Mouse. J Neurosci. 2001;21(20):8278–85. 29. Lazzari VM, Becker RO, de Azevedo MS, Morris M, Rigatto K, Almeida S, et al. Oxytocin modulates social interaction but is not essential for sexual behavior in male mice. Behav Brain Res. 2013;244:130–6. 30. Becker RO, Lazzari VM, Menezes IC, Morris M, Rigatto K, Lucion AB, et al. Sexual behavior and dendritic spine density of posterodorsal medial amygdala neurons in oxytocin knockout female mice. Behav Brain Res. 2013;256:95–100. 31. Wettschureck N, Moers A, Hamalainen T, Lemberger T, Schütz G, Offermanns S. Heterotrimeric G proteins of the Gq/11 family are crucial for the induction of maternal behavior in mice. Mol Cell Biol. 2004;24(18):8048–54. 32. Reversi A, Rimoldi V, Marrocco T, Cassoni P, Bussolati G, Parenti M, et al. The oxytocin receptor antagonist atosiban inhibits cell growth via a ―biased agonist‖ mechanism. J Biol Chem. 2005;280(16):16311–8. 33. Alberts AS, Arias J, Hagiwara M, Montminy MR, Feramisco JR. Recombinant cyclic AMP response element binding protein (CREB) phosphorylated on Ser-133 is transcriptionally active upon its introduction into fibroblast nuclei. J Biol Chem. 1994;269(10):7623–30. 34. Insel TR, Gelhard R, Shapiro LE. The comparative distribution of forebrain receptors for neurohypophyseal peptides in monogamous and polygamous mice. Neuroscience. 1991;43(2–3):623–30. 35. Bale TL, Davis AM, Auger AP, Dorsa DM, McCarthy MM. CNS region-specific oxytocin receptor expression: importance in regulation of anxiety and sex behavior. J Neurosci. 2001;21(7):2546–52. 36. Morris M, Callahan MF, Li P, Lucion AB. Central Oxytocin Mediates Stress Induced Tachycardia. J Neuroendocrinol. 1995;7(6):455–9. 37. Pedersen CA, Caldwell JD, Walker C, Ayers G, Mason GA. Oxytocin activates the postpartum onset of rat maternal behavior in the ventral tegmental and medial preoptic areas. Behav Neurosci. 1994;108(6):1163–71. 38. Veinante P, Freund-Mercier MJ. Distribution of oxytocin- and vasopressin-binding sites in the rat extended amygdala: A histoautoradiographic study. J Comp Neurol. 1997;383(3):305–25. 39. Mitre M, Marlin BJ, Schiavo JK, Morina E, Norden SE, Hackett TA, et al. A Distributed Network for Social Cognition Enriched for Oxytocin Receptors. J Neurosci. 2016;36(8):2517–35. 32 40. Panatier A. Glial cells: Indispensable partners of hypothalamic magnocellular neurones. J Neuroendocrinol. 2009;21(7):665–72. 41. Yoshida M, Takayanagi Y, Inoue K, Kimura T, Young LJ, Onaka T, et al. Evidence That Oxytocin Exerts Anxiolytic Effects via Oxytocin Receptor Expressed in Serotonergic Neurons in Mice. J Neurosci. 2009;29(7):2259–71. 42. Choleris E, Clipperton-Allen AE, Phan A, Valsecchi P, Kavaliers M. Estrogenic involvement in social learning, social recognition and pathogen avoidance. Front Neuroendocrinol. 2012;33(2):140–59. 43. Skuse DH, Gallagher L. Dopaminergic-neuropeptide interactions in the social brain. Trends Cogn Sci. 2009;13(1):27–35. 44. Wacker DW, Ludwig M. Vasopressin, oxytocin, and social odor recognition. Horm Behav. 2012;61(3):259–65. 45. Stevenson EL, Caldwell HK. The vasopressin 1b receptor and the neural regulation of social behavior. Horm Behav. 2012;61(3):277–82. 46. Bielsky IF, Young LJ. Oxytocin, vasopressin, and social recognition in mammals. Peptides. 2004;25(9):1565–74. 47. Winslow JT, Insel TR. Neuroendocrine basis of social recognition. Curr Opin Neurobiol. 2004;14(2):248–53. 48. de Vries GJ, Södersten P. Sex differences in the brain: The relation between structure and function. Horm Behav. 2009;55(5):589–96. 49. Gupta J, Russell R, Wayman C, Hurley D, Jackson V. Oxytocin-induced contractions within rat and rabbit ejaculatory tissues are mediated by vasopressin V1A receptors and not oxytocin receptors. Br J Pharmacol. 2008;155(April):118–26. 50. Donaldson Z. R, Young LJ. Oxytocin, Vasopressin and the neurogenics of sociality. Science (80). 2008;322:900–5. 51. Insel TR, Young LJ. The neurobiology of attachment. Nat Rev Neurosci. 2001;2(2):129–36. 52. Goodson JL, Bass AH. Social behavior functions and related anatomical characteristics of vasotocin / vasopressin systems in vertebrates. 2001;35:246–65. 53. Lim MM, Wang Z, Olazábal DE, Ren X, Terwilliger EF, Young LJ. Enhanced partner preference in a promiscuous species by manipulating the expression of a single gene. Nature. 2004;429(6993):754–7. 54. Baskerville TA, Douglas AJ. Dopamine and oxytocin interactions underlying behaviors: Potential contributions to behavioral disorders. CNS Neurosci Ther. 33 2010;16(3):92–123. 55. Wang Z, Yu G, Cascio C, Liu Y, Gingrich B, Insel TR. Dopamine D2 receptor- mediated regulation of partner preferences in female prairie voles (Microtus ochrogaster): a mechanism for pair bonding? Behav Neurosci. 1999;113(3):602–11. 56. Wang Z, Aragona BJ. Neurochemical regulation of pair bonding in male prairie voles. Physiol Behav. 2004;83(2):319–28. 57. Rocchetti J, Isingrini E, Dal Bo G, Sagheby S, Menegaux A, Tronche F, et al. Presynaptic D2 dopamine receptors control long-term depression expression and memory processes in the temporal hippocampus. Biol Psychiatry. 2015;77(6):513–25. 58. Bonci A, Hopf FW. The dopamine D2 receptor: New surprises from an old friend. Vol. 47, Neuron. 2005. p. 335–8. 59. Anzalone A, Lizardi-Ortiz JE, Ramos M, De Mei C, Hopf FW, Iaccarino C, et al. Dual control of dopamine synthesis and release by presynaptic and postsynaptic dopamine D2 receptors. J Neurosci. 2012;32(26):9023–34. 60. Melis MR, Argiolas A. Central control of penile erection: A re-visitation of the role of oxytocin and its interaction with dopamine and glutamic acid in male rats. Neurosci Biobehav Rev. 2011;35(3):939–55. 61. Ogawa S, Lubahn DB, Korach KS, Pfaff DW. Behavioral effects of estrogen receptor gene disruption in male mice. Proc Natl Acad Sci U S A. 1997;94(4):1476–81. 62. Waldherr M, Neumann ID. Centrally released oxytocin mediates mating-induced anxiolysis in male rats. Proc Natl Acad Sci U S A. 2007;104(42):16681–4. 63. Broad KD. Previous maternal experience potentiates the effect of parturition on oxytocin receptor mRNA expression in the paraventricular nucleus. Eur J Neurosci. 1999;11(10):3725–37. 64. De Olmos JS, Beltramino CA, Alheid G. Amygdala and Extended Amygdala of the Rat: A Cytoarchitectonical, Fibroarchitectonical, and Chemoarchitectonical Survey. In: The Rat Nervous System. 2004. p. 509–603. 65. Brennan P a. The vomeronasal system. Cell Mol life Sci. 2001;58(4):546–55. 66. M.Witt D. Oxytocin and rodent sociosexual responses: from behavior to gene expression. Neurosci Biobehav Rev. 1995;19(2):315–24. 67. Brennan PA, Keverne EB. Something in the Air? New Insights into Mammalian Pheromones. Vol. 14, Current Biology. 2004. 68. Keverne EB. The Vomeronasal Organ. Science (80- ) [Internet]. 1999;286:716–20. Available from: http://www.jstor.org/stable/2899372 34 69. Pfaff DW, Schwartz-Giblin S. Cellular Mechanisms of Female Reproductive Behaviors. Physiol Reprod (eds E Knobil J Neill) New York Raven Press. 1988;1487– 568. 70. Yang T, Shah NM. Molecular and neural control of sexually dimorphic social behaviors. Curr Opin Neurobiol. 2016;38:89–95. 71. Yang CF, Shah NM. Representing sex in the brain, one module at a time. Vol. 82, Neuron. 2014. p. 261–78. 72. Anderson DJ. Optogenetics, sex, and violence in the brain: Implications for psychiatry. Biol Psychiatry. 2012;71(12):1081–9. 73. Lin D, Boyle MP, Dollar P, Lee H, Lein ES, Perona P, et al. Functional identification of an aggression locus in the mouse hypothalamus. Nature. 2011;470(7333):221–6. 74. Scott N, Prigge M, Yizhar O, Kimchi T. A sexually dimorphic hypothalamic circuit controls maternal care and oxytocin secretion. Nature. 2015;525(7570):519–22. 75. Yang CF, Chiang MC, Gray DC, Prabhakaran M, Alvarado M, Juntti SA, et al. Sexually dimorphic neurons in the ventromedial hypothalamus govern mating in both sexes and aggression in males. Cell. 2013;153(4):896–909. 76. Lee H, Kim D-W, Remedios R, Anthony TE, Chang A, Madisen L, et al. Scalable control of mounting and attack by Esr1+ neurons in the ventromedial hypothalamus. Nature. 2014;509(7502):627–32. 77. Argiolas A, Melis MR. Neuropeptides and central control of sexual behaviour from the past to the present: A review. Prog Neurobiol. 2013;108:80–107. 78. Fuster JM. The Prefrontal Cortex—An Update. Neuron. 2001;30(2):319–33. 79. Stoop R. Neuromodulation by oxytocin and vasopressin in the central nervous system as a basis for their rapid behavioral effects. Curr Opin Neurobiol [Internet]. 2014;29:187–93. Available from: http://dx.doi.org/10.1016/j.conb.2014.09.012 80. Davis JF, Loos M, Di Sebastiano AR, Brown JL, Lehman MN, Coolen LM. Lesions of the Medial Prefrontal Cortex Cause Maladaptive Sexual Behavior in Male Rats. Biol Psychiatry. 2010;67(12):1199–204. 81. Bicks LK, Koike H, Akbarian S, Morishita H. Prefrontal Cortex and Social Cognition in Mouse and Man. Front Psychol. 2015 Nov 26;6:1805. 82. Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O’Shea DJ, et al. Neocortical excitation/inhibition balance in information processing and social dysfunction. Nature. 2011;477(7363):171–8. 83. Hliák Z, Krejčí I. N-Methyl-D-aspartate improved social recognition potency in rats. 35 Neurosci Lett. 2002;330(3):227–30. 84. Kim Y, Venkataraju KU, Pradhan K, Mende C, Taranda J, Turaga SC, et al. Mapping social behavior-induced brain activation at cellular resolution in the mouse. Cell Rep. 2015;10(2):292–305. 85. Wang F, Zhu J, Zhu H, Zhang Q, Lin Z, Hu H. Bidirectional Control of Social Hierarchy by Synaptic Efficacy in Medial Prefrontal Cortex. Science (80- ). 2011;334(6056):693–7. 86. Takahashi A, Nagayasu K, Nishitani N, Kaneko S, Koide T. Control of intermale aggression by medial prefrontal cortex activation in the mouse. PLoS One. 2014;9(4). 87. Nevison CM, Barnard CJ, Beynon RJ, Hurst JL. The consequences of inbreeding for recognizing competitors. Proc Biol Sci / R Soc. 2000;267(1444):687–94. 88. Kavaliers M, Agmo A, Choleris E, Gustafsson JA, Korach KS, Muglia LJ, et al. Oxytocin and estrogen receptor a and b knockout mice provide discriminably different odor cues in behavioral assays. Genes, Brain Behav. 2004;3(4):189–95. 89. Kavaliers M, Colwell DD, Choleris E, Agmo A, Muglia LJ, Ogawa S, et al. Impaired discrimination of and aversion to parasitized male odors by female oxytocin knockout mice. Genes Brain Behav. 2003;2(4):220–30. 90. Dudek SM, Alexander GM, Farris S. Rediscovering area CA2: unique properties and functions. Nat Rev Neurosci. 2016;17(2):89–102. 91. Lorente De Nó R. Studies on the structure of the cerebral cortex. II. Continuation of the study of the ammonic system. J für Psychol und Neurol. 1934;46:113–7. 92. Pouille F, Scanziani M. Enforcement of temporal fidelity in pyramidal cells by feed- forward somatic inhibition. Science (80- ). 2001;293(5532):325–31. 93. Owen SF, Tuncdemir SN, Bader PL, Tirko NN, Fishell G, Tsien RW. Oxytocin enhances hippocampal spike transmission by modulating fast-spiking interneurons. Nature. 2013;500(7463):458–62. 94. Glickfeld LL, Scanziani M. Distinct timing in the activity of cannabinoid-sensitive and cannabinoid-insensitive basket cells. Nat Neurosci. 2006;9(6):807–15. 95. Jones MW, Mchugh TJ. Updating hippocampal representations: CA2 joins the circuit. Vol. 34, Trends in Neurosciences. 2011. p. 526–35. 96. Pagani JH, Zhao M, Cui Z, Avram SKW, Caruana DA, Dudek SM, et al. Role of the Vasopressin 1b Receptor in Rodent Aggressive Behavior and Synaptic Plasticity in Hippocampal Area CA2. Mol Psychiatry. 2015;20(4):490–9. 97. Hatanpaa KJ, Raisanen JM, Herndon E, Burns DK, Foong C, Habib A a, et al. 36 Hippocampal sclerosis in dementia, epilepsy, and ischemic injury: differential vulnerability of hippocampal subfields. J Neuropathol Exp Neurol. 2014;73(2):136–42. 98. Williamson A, Spencer DD. Electrophysiological characterization of CA2 pyramidal cells from epileptic humans. Hippocampus. 1994;4(2):226–37. 99. Zhao M, Choi Y-S, Obrietan K, Dudek SM. Synaptic plasticity (and the lack thereof) in hippocampal CA2 neurons. J Neurosci. 2007;27(44):12025–32. 100. Hitti FL, Siegelbaum SA. The hippocampal CA2 region is essential for social memory. Nature. 2014;508(7494):88–92. 101. Young WS, Li J, Wersinger SR, Palkovits M. The vasopressin 1b receptor is prominent in the hippocampal area CA2 where it is unaffected by restraint stress or adrenalectomy. Neuroscience. 2006;143(4):1031–9. 102. Rochefort NL, Konnerth A. Dendritic spines: from structure to in vivo function. EMBO Rep. 2012;13(8):699–708. 103. Woolf NJ. A structural basis for memory storage in mammals. Vol. 55, Progress in Neurobiology. 1998. p. 59–77. 104. Segal M. Dendritic spines, synaptic plasticity and neuronal survival: Activity shapes dendritic spines to enhance neuronal viability. Eur J Neurosci. 2010;31(12):2178–84. 105. Peters A, Kaiserman-Abramof IR. The small pyramidal neuron of the rat cerebral cortex - The synapses upon dendritic spines. Zeitschrift für Zellforsch und Mikroskopische Anat. 1969;100(4):487–506. 106. Gonzalez-Burgos I, Rivera-Cervantes MC, Velazquez-Zamora DA, Feria-Velasco A, Garcia-Segura LM. Selective estrogen receptor modulators regulate dendritic spine plasticity in the hippocampus of male rats. Neural Plast. 2012;2012. 107. Pereira LDV. Animais Transgênicos–Nova Fronteira Do Saber. Ethics [Internet]. 2008;60:40–2. Available from: http://cienciaecultura.bvs.br/pdf/cic/v60n2/a17v60n2.pdf 108. Nishimori K, Young LJ, Guo Q, Wang Z, Insel TR, Matzuk MM. Oxytocin is required for nursing but is not essential for parturition or reproductive behavior. Proc Natl Acad Sci U S A. 1996;93(21):11699–704. 109. Young III WS, Shepard E, Amico J, Hennighausen L, Wagner K-U, LaMarca ME, et al. Deficiency in Mouse Oxytocin Prevents Milk Ejection,but not Fertility or Parturition. J Neuroendocrinol [Internet]. 1996 Nov;8(11):847–53. Available from: http://doi.wiley.com/10.1046/j.1365-2826.1996.05266.x 110. Gross G a, Imamura T, Luedke C, Vogt SK, Olson LM, Nelson DM, et al. Opposing 37 actions of prostaglandins and oxytocin determine the onset of murine labor. Proc Natl Acad Sci U S A. 1998;95(20):11875–9. 111. DeVries a C, Young WS, Nelson RJ. Reduced aggressive behaviour in mice with targeted disruption of the oxytocin gene. J Neuroendocrinol. 1997;9(5):363–8. 38 2 JUSTIFICATIVA Muitos estudos sobre comportamento têm buscado entender os mecanismos moleculares e citológicos que regulam processos comportamentais básicos. A genética e a biologia molecular têm contribuído sobremaneira na identificação de genes associados a determinados comportamentos e como alterações genéticas ou fatores ambientais podem interferir na expressão desses genes. O modelo de experimentação utilizando animais nocautes para um determinado gene permite avaliar as alterações fisiológicas e comportamentais geradas a partir desta manipulação genética (107). Estudos utilizando camundongos OTKO apontaram para alterações nos comportamentos sociais destes animais (25,28,60,108,111) e o desfecho comportamental descrito nestes trabalhos prévios foi associado à falta de OT. Contudo, os circuitos neurais envolvidos em um comportamento não estão associados a apenas um neuropeptídeo. Vários neurotransmissores, seus níveis de liberação e função precisam estar adequados para que, em conjunto, realizem a ativação neuronal correta para o padrão comportamental em questão. Neste contexto, uma alteração na expressão gênica pode desencadear uma série de outras alterações que contribuem para os déficits encontrados em animais nocautes. Mas quais seriam estas alterações secundárias? Em qual região do sistema nervoso elas se localizam? Quais outros neurotransmissores podem estar afetados pela falta de OT? Estas alterações poderiam estar modificando a morfologia dos neurônios envolvidos? A partir das alterações observadas nos comportamentos sociais dos animais OTKO e das lacunas no entendimento dos mecanismos que desencadeiam estes padrões comportamentais, tornam-se necessários estudos que possam esclarecer o impacto do nocauteamento do gene da OT no SNC destes animais. Para compreender este impacto, animais OTKO devem ser estudados para os padrões comportamentais descritos e seus neurotransmissores/neuropeptídeos e receptores devem ser analisados em várias áreas envolvidas com o comportamento social. Sabendo-se qual área tem padrões de expressão mais alterados, busca-se então entender como os neurônios desta área se alteram frente a estes diferentes padrões, através da análise da densidade e morfologia de espinhos dendríticos. 39 3 OBJETIVOS 3.1 Objetivo geral Este estudo teve como objetivo analisar o impacto do nocauteamento do gene da ocitocina nos comportamentos sexual e de interação social; na concentração plasmática e na expressão hipotalâmica de vasopressina e na expressão gênica dos receptores de ocitocina, vasopressina, dopamina e estrogênio em regiões encefálicas importantes aos comportamentos sociais. Além disso, analisar o impacto do nocauteamento do gene da ocitocina e da experiência sexual na densidade e morfologia de espinhos dendríticos em CA2 do hipocampo de camundongos machos. 3.2 Objetivos específicos - Analisar os comportamentos de interação social e sexual de camundongos machos nocautes para a ocitocina (artigo 1); - Estudar se o nocauteamento do gene da ocitocina altera concentração plasmática de vasopressina em machos nocautes para a ocitocina (artigo 1); - Analisar a expressão do receptor de ocitocina, estrogênio α e β, dopamina, vasopressina 1a e 1b no bulbo olfatório, hipotálamo, córtex pré-frontal e hipocampo de machos nocautes para a ocitocina (artigo 2); - Estudar se o nocauteamento do gene da ocitocina altera a síntese de vasopressina no hipotálamo de machos nocautes para a ocitocina (artigo 2); - Analisar o impacto do nocauteamento do gene da ocitocina e da experiência sexual na densidade e morfologia de espinhos dendríticos na área CA2 do hipocampo de camundongos machos (artigo 3). 40 4 ARTIGOS 4.1 ARTIGO 1: Oxytocin modulates social interaction behavior but is not essential for sexual behavior in male mice Virgínia Meneghini Lazzari, Roberta Ouriques Becker, Marcia Scherem de Azevedo, Mariana Morris, Kátia Viana Rigatto, Silvana de Almeida, Aldo Bolten Lucion, Márcia Giovenardi Revista escolhida: Behavioural Brain Research Fator de Impacto: 3.002 Link para acesso on-line: http://www.sciencedirect.com/science/article/pii/S0166432813000442 DOI: 10.1016/j.bbr.2013.01.025 41 42 43 44 45 46 47 48 4.2 ARTIGO 2: Oxytocin gene knockout alters the gene expression of oxytocin, vasopressin 1b and dopamine 2 receptors in the hippocampus of male mice Virginia Meneghini Lazzari, Josi Maria Zimmermann-Peruzatto, Grasiela Agnes, Roberta Oriques Becker, Ana Carolina de Moura, Silvana Almeida, Renata Padilha Guedes, Marcia Giovenardi Submetido à Revista: Brain Research Bulletin Fator de Impacto: 2.96 Guide for Authors: https://www.elsevier.com/journals/brain-research-bulletin/0361-9230/guide-for-authors 49 OXYTOCIN GENE KNOCKOUT ALTERS THE GENE EXPRESSION OF OXYTOCIN, VASOPRESSIN 1B AND DOPAMINE 2 RECEPTORS IN THE HIPPOCAMPUS OF MALE MICE Virginia Meneghini Lazzari 1,4* , Josi Maria Zimmermann-Peruzatto 2 , Grasiela Agnes 1 , Roberta Oriques Becker 1 , Ana Carolina de Moura 1 , Silvana Almeida 1,3 , Renata Padilha Guedes 1 , Marcia Giovenardi 1,3 1 Programa de Pós-Graduação em Ciências da Saúde, Universidade Federal de Ciências da Saúde de Porto Alegre (UFCSPA), Porto Alegre, Brasil 2 Doutora em Fisiologia, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brasil 3 Programa de Pós-Graduação em Biociências, Universidade Federal de Ciências da Saúde de Porto Alegre (UFCSPA), Porto Alegre, Brasil 4 Centro Universitário Ritter dos Reis (UniRitter), Porto Alegre, Brasil * Corresponding author 50 ABSTRACT Oxytocin (OT) and vasopressin (AVP) and a number of neurotransmitter systems play critical roles in social behaviors. In this work, we investigated the relationship between important brain areas and neurotransmitter receptors involved in social behaviors and lack of OT in OT-knockout (OTKO) male mice. We analyzed the gene expression levels of OT receptor (OTR), AVP receptors 1a and 1b (V1aR; V1bR), dopamine receptor 2 (D2R), and the estrogen receptors alpha and beta (ERa; ERb) in the hippocampus (HPC), olfactory bulb (OB), hypothalamus (HPT) and prefrontal cortex (PFC). AVP gene expression was analyzed in the HPT. We extracted RNA, synthesized cDNAs and measured gene expression with quantitative polymerase chain reaction. The absence of OT in the OTKO mice altered gene expression in the HPC; OTKOs exhibited decreased expression levels of D2R and V1bR and increased expression levels of OTR. No differences were detected in OB and HPT. Only ERb was increased in the PFC and we found reduced AVP expression levels in the HPT of the OTKOs. For the first time, we showed that OTKO male mice exhibit changes in the gene expression levels of receptors involved in other neuroendocrine systems, and these findings were more prominent in the HPC. Key words: estrogen receptor; prefrontal cortex; hypothalamus; olfactory bulb. 51 1. INTRODUCTION Recognition and social interaction between animals are crucial skills for the survival and life in groups (Choleris et al., 2009). Many studies have demonstrated that, in addition to classical hormonal functions, oxytocin (OT) and vasopressin (AVP) play critical roles in the social behaviors in mammals (Choleris et al., 2012; Guastella et al., 2011; Matsushita et al., 2010). OT and AVP are released into the brain from the parvocellular cells of the hypothalamus (HPT) (Bielsky and Young, 2004). These neuropeptides are present in many areas of the central nervous system (CNS) related to social behavior, such as the hippocampus (HPC), medial preoptic area (MPOA), nucleus accumbens (NAc), HPT, olfactory bulb (OB), fusiform area, superior temporal gyrus, amygdala, prefrontal cortex (PFC) and temporal cortex (for a review, see (Insel and Fernald, 2004)). Several molecular and pharmacological studies have demonstrated the critical role of OT and AVP in the neuronal processing of olfactory signatures used for social discrimination and social cognition (Bielsky and Young, 2004; Ferguson et al., 2000; Winslow and Insel, 2002). In addition, a previous study (Ferguson et al., 2001) showed that OT knockout mice (OTKO) fail to recognize familiar conspecifics after repeated social exposure, and OT treatment in the medial amygdala during the initial social exposure fully restores social recognition. Additionally, in our previous study, we analyzed social investigation behaviors using a social interaction test, and we showed that OTKO male mice exhibited a decrease in social behavior and aggressive performance (Lazzari et al., 2013). Similar to OT, the lack of AVP in male rats leads to an impairment in social recognition. This impairment was rescued by AVP administration into the septum, which provides evidence for a physiological role of AVP in this behavior (Engelmann and Landgraf, 1994). Moreover, vasopressin 1a receptor (V1aR) knockout mice show complete impairment in 52 social recognition, whereas vasopressin 1b receptor (V1bR) knockout mice only demonstrated partial impairment (for a review, see (Choleris et al., 2009)). In addition to OT and AVP, other neurobiological systems also contribute to social interaction in rodents. Animal models seem to indicate the existence of broad and integrated brain circuits where interactions between dopamine (DA) and OT mediate social behaviors. Both OT and DA play a role in social recognition/memory within the OB; however, DA, especially through the D2 receptors (D2R), plays a more prominent role in the consolidation of memory rather than recognition (Insel and Young, 2001). Moreover, sex hormones are also relevant in this context. In particular, estrogens appear to facilitate social recognition by promoting the activity of OT through the specific activation of the estrogen alpha and beta receptors (ERa and ERb) (Choleris et al., 2003). Based on the intricate relationship already described between OT and social behavior and the question of whether other neurotransmitters are associated with changes in OT expression, we investigated the gene expression levels of neurotransmitter receptors in the CNS of OTKO male mice. We selected important areas for male social behaviors and the neurotransmitters related to these behaviors to investigate the effects of the loss of OT. Specifically, this study evaluated the gene expression levels of the OT receptor (OTR), V1aR, V1bR, D2R, ERa and ERb in the HPC, OB, HPT, PFC of male mice. Additionally, we analyzed the influence of OT deletion on the AVP mRNA expression levels in the HPT. 2 MATERIAL AND METHODS 2.1 Animals This study was conducted with the offspring from a backcrossed stock obtained from Dr. W. Scott Young (B6; 129S-Oxttm1 Wsy/J; NIMH, USA). OTKO mice were developed by gene targeting to eliminate most of the first intron and the last two exons of the OT gene, 53 as previously described by Young (Young III et al., 1996). All mice were littermates from heterozygous breeders. Male mice [n=4 to 10 for the control group (WT); n=4 to 10 for the OTKO group] were housed in ventilated, transparent acrylic cages (37 cm × 24 cm × 24 cm) with up to five male mice per cage. All mice had free access to water and food under controlled temperature (21 ± 1°C) and light (12:12 light-dark cycle with lights off at 5 pm) conditions. All procedures were performed in accordance with the Brazilian Society of Neuroscience and the Guide for the Care and Use of Laboratory Animals (2011), as well as the international laws for the care of laboratory animals. The local Ethics Committee approved the protocols (UFCSPA, Brazil, protocol n°. 233/13). 2.2 Genotyping To determine the genotypes of the mice, genomic DNA isolated from mouse tail samples was collected (Andersen and Tufik, 2015) and used as a template for polymerase chain reaction. Genotyping was carried out as previously described by our group (Lazzari et al., 2013). The primer sequences for amplification of the WT alleles involved the forward primer 5’-CTTGGCTTACTGGCTCTGACCT-3’ and the reverse primer 5’- GTCAAGAGGGAGCCTAACACTTC-3’. To amplify the target allele, an additional forward primer (NEO) was used: 5’-TGCCCCAAAGGCCTACCCGCTTCC-3’. After genotyping, the mice were assigned to either the WT or OTKO groups; the brain tissue samples were collected as follows. 2.3 Brain tissue samples The brain tissue samples were collected from male mice between 6 and 8 months old (25 to 35 g) in the morning during the light cycle in a noiseless room. The mice were decapitated, the brains were removed and the areas of interest were quickly dissected. The OB, HPC, HPT and PFC from the left hemisphere were collected with a stereomicroscope on 54 ice using sterile materials. The dissection of the structures was performed as previously described (Moura et al., 2014; Zimmermann-Peruzatto et al., 2016) and illustrated by Chiu et al. (Chiu et al., 2007), following the maps and guides to dissection published by Paxinos and Franklin (Paxinos and Franklin, 2012) to separate each specific brain area of interest for the present study. 2.4 Molecular Analysis 2.4.1 RNA extraction and cDNA synthesis Total RNA was isolated from the brain samples using TRIzol reagent (Invitrogen, São Paulo, Brazil), according to the manufacturer’s guidelines. Each structure was homogenized with TRIzol (1 mL), followed by the addition of chloroform (1:5, v/v), and the aqueous phase was separated by centrifugation (12,000 g, 15 min). RNA was precipitated with isopropanol for 15 min, followed by centrifugation at 12,000 g for 10 min. Then, the isopropanol was discarded, and the pellets were resuspended in 0.1% DEPC-treated water. The concentration of total RNA was determined by measuring the optical density at 260 nm, and the RNA purity was assessed based on the 260 nm/280 nm ratio (BioSpec-nano, Shimadzu). Total RNA (patronized in 1000 ng) was reverse-transcribed with M-MLV reverse transcriptase (Invitrogen, São Paulo, Brazil), according to the manufacturer’s guidelines. RNA was first incubated with 1 µL oligo (dT) (0.5 µg/µL, Invitrogen, São Paulo, Brazil), 1 µL 10 mM dNTPs and DEPC-water for a final volume of 12 µL for 5 min at 65°C and then 1 min on ice. The following reagents were then added: 4 µL RT buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2), 2 µL 0.1 M DTT, and 1 µL RNaseOUT (40 U/µL, Invitrogen, São Paulo, Brazil). After a 2-min incubation at 37°C, 1 µL M-MLV-RT (200 U/µL, Invitrogen, São Paulo, Brazil) was added, and cDNA synthesis was performed at 50°C for 1 h. The reaction was inactivated by incubation at 70°C for 15 min. 55 2.4.2 Real Time PCR (qPCR) The cDNA (1 μL) was subjected to RT-qPCR in a StepOnePlus™ thermocycler (Applied Biosystems, Foster City, CA, USA) using the SYBR® Green PCR Master Mix (Applied Biosystems, São Paulo, Brazil) for OTR, D2R, ERa and ERb. Taqman® probes (Applied Biosystems, São Paulo, Brazil) were used for V1aR and V1bR. The primers for all target genes, as well as for the reference genes [(beta-actin (ActB) and cyclophilin-A (CypA)], are provided in Table 1. The Taqman® gene expression assays used for V1aR, V1bR and beta-actin (ActB) are Mm 00444092_m 1, Mm 01700416_m 1 and Mm 00607939_s 1, respectively. The amplification for the OTR, D2R, ERa, ERb, AVP, and reference genes [(beta-actin (ActB) and cyclophilin-A (CypA)] was carried out using 7.5 μL of SYBR Green PCR Master Mix (Applied Biosystems, São Paulo, Brazil), 0.5 μL of forward and reverse primers (0.33 µM each), and 100 ng of cDNA and nuclease-free water for a total volume of 15 μL. For the SYBR Green reactions, amplification was followed by a melting curve analysis to confirm the PCR product specificity. Taqman® probes were used for the amplification of the genes V1aR, V1bR and ActB. This protocol includes a final volume of 7.5 μl of master mix (Applied Biosystems, São Paulo, Brazil), 0.5 μL of each probe, and a cDNA concentration of 100 ng. No signals were detected in non-template controls. The experimental Ct (cycle threshold) was calculated using the algorithm enhancements provided with the equipment. The Ct value of each reaction was used to calculate the level of mRNA expression of that specific gene, after normalization to the expression of the control housekeeping genes (HKG) that were analyzed in parallel in the same reaction plate. Relative gene expression was calculated by the 2 -ΔΔCt method using samples from the control group as calibrator samples (Livak and Schmittgen, 2001). All samples were analyzed 56 in duplicate, and the mean value of each duplicate was used for all further calculations (Moura et al., 2014; Zimmermann-Peruzatto et al., 2016). 2.5 Statistical Analysis The data distribution was assessed by Agostino and Pearson omnibus normality test. The data were not normally distributed and were thus compared using Mann-Whitney test. The results are expressed as the mean ± SEM, and in all cases, P<0.05 was considered statistically significant. 3. RESULTS The gene expression results for the HPC are shown in Figure 1. The OTKO group showed a significant increase in the OTR gene expression levels (U=11.00, P=0.028) and a significant decrease in the D2R (U=8.00, P=0.020) and V1bR (U=2.00, P=0.017) gene expression levels compared to the WT group. The gene expression levels of V1aR (U=16.00, P=0.818), ERa (U=24.00, P=0.694) and ERb (U=19.00, P=0.573) were not significantly different between the groups. We found a significant decrease in the mRNA synthesis of AVP in the HPT of the OTKO group compared to WT (U=4.00, P=0.048), as shown in Figure 2. However, we did not find significant differences in the gene expression levels of any of the receptors evaluated in the HPT (Table 2). In the PFC, the OTKO group exhibited increased gene expression levels of ERb compared to WT. However, there were no significant differences between the groups in the gene expression levels of the other receptors in the PFC. In addition, in the OB, we found no significant differences in the gene expression levels of any of the investigated receptors 57 between the WT and OTKO groups. We assessed the expression levels of V1bR in all areas, but we only detected amplification of this receptor in both groups in the HPC (Table 2). 4. DISCUSSION The importance of OT for social behavior has already been previously demonstrated and appears to be modulating the hippocampal mechanisms related to memory retention (Choleris et al., 2003; Ferguson et al., 2000; Winslow and Insel, 2002). Here, we showed that the deletion of OT in male mice leads to changes in the gene expression of receptors involved in other neuroendocrine systems related to social behaviors, and these findings are more prominent in the HPC. Therefore, the action of OT in this area is mainly related to the action of AVP and DA, since the receptors of these neurotransmitters have been altered in OTKO animals. The previously described (Lazzari et al., 2013) impairment in social behavior and in aggression scores in OTKO males shows the importance of OT for the correct behavioral outcome. Owen et al., 2013 described the hippocampal mechanism by which OT enhances processing of information through an increase in fast-spiking interneuron activity. This activation can improve the performance of neuronal circuitry that requires synapse specificity and millisecond precision. In the present study, the lack of OT potentially suppressed this mechanism in the OTKO group. Thus, we assume that this suppression could be associated with the alterations in the V1bR, D2R and OTR, which can be decreasing social behavior and aggression. The increased OTR gene expression in the HPC of the OTKO group possibly indicates the existence of a compensatory mechanism. Due to the lack of OT, transcriptional and translational mechanisms may lead to an upregulation of the expression levels of the OTR 58 (Gimpl et al., 2001). Indeed, this result is interesting because we only found this increase in the HPC, which demonstrates the importance of OT as a modulatory neuropeptide in this area. The interaction between the DA and OT systems is very well described; an increase in DA release to the central amygdala is involved in the regulation of the OTR gene expression levels (Bale et al., 2001; Skuse and Gallagher, 2009). In the HPC, DA is also essential for learning and memory circuits, especially through D2R activation (Rocchetti et al., 2015). Therefore, we hypothesize that the decrease in the D2R gene expression levels probably contributes to behavioral impairments observed in the OTKO animals (Ferguson et al., 2000; Winslow and Insel, 2002). AVP is involved in social behavior by acting on the centrally expressed V1aR and V1bR (Stevenson and Caldwell, 2012). Regarding the expression of V1bR in the HPC, we found decreased gene expression levels of this receptor in the OTKO group. Previous studies using V1bR knockout mice showed a significant deficit in social recognition, social memory and aggressive behavior in specific social contexts (Pagani et al., 2015; Stevenson and Caldwell, 2012; Winslow and Insel, 2004). Interestingly, the OTKO group exhibits a reduction in the V1bR gene expression levels in the HPC, which may contribute to the behavioral changes previously demonstrated by our group (Lazzari et al., 2013). This relationship between OT and V1bR in the HPC is a novel finding that reinforces the importance of the role of neuropeptides in social behavior. Previous studies (Ozaki et al., 2004; Young III et al., 1996) have shown that the transcription levels of the AVP gene are reduced in the PVN and SON in OTKO mice. As expected, in the present study, we found a decrease in the AVP expression levels in the HPT of the OTKO male mice. Decreased AVP has only been described in mice with exon 2 deletion of the OT gene, which is similar to the animals used in the present study; the deletion of exon 1 of the OT gene does not affect the expression of AVP (Winslow and Insel, 2002). 59 On the other hand, our laboratory previously demonstrated that OTKO female mice exhibit no differences in the transcription levels of AVP in the HPT (Zimmermann-Peruzatto et al., 2016). Other studies have also demonstrated lower AVP plasma concentrations in OTKO males, while the concentrations in OTKO females were not different from that in WT mice (Becker et al., 2013; Lazzari et al., 2013). These intriguing results regarding AVP gene expression in the HPT suggest that OT could modulate AVP synthesis in males but not in females, and this outcome could be due to the sexually dimorphic effects of AVP. The formation of memory depends on the integrity of the HPC circuits but also involves a large network of cortical areas that includes the adjacent parahippocampal region and the PFC (Lee and Chirwa, 2015). We found an increase in the ERb gene expression levels in the PFC of the OTKO males. A previous study (Wide et al., 2004) in female mice found that high levels of PFC estradiol impair working memory, while low levels facilitate it. Studies with ERa and ERb knockout animals revealed that ERa in the SNC of males may facilitate social memory retention; ERb seems to play a smaller faciliatory role that may only emerge under more challenging testing conditions (for a review, see (Choleris et al., 2012)). We found no differences in the expression levels of ERa in all studied areas and only found differences in the expression levels of ERb in the PFC. These results indicate a potential relationship between ERb and the lack of OT specifically within the PFC, which may help elucidate the mechanisms underlying the behavioral modulation. The complexity of social behavior also depends on individual recognition, and the OB plays a crucial role in the initial information processing involved in this process. Despite the importance of this area for social behavior, surprisingly the OTKO group exhibited no differences in the gene expression levels of the studied receptors in the OB. Thus, in this region, OT appears to be nonessential for the modulation of the expression of these neuroendocrine receptors. 60 5. CONCLUSIONS Our data showed the relationship between OT and other neurotransmitters to relevant areas previously associated with social behavior. The findings of this study indicate the importance of OT in the HPC since there were alterations in the transcription patterns of V1bR and D2R in addition to OTR in this area. In addition, we associated the absence of OT with a reduction in the AVP gene expression levels in the HPT, which demonstrates the relationship between the functions of these peptides in the brains of male mice. These findings provide insights into the contributions of OT to deficiencies in social behavior and highlight the involvement of other neurotransmitters in this context. ACKNOWLEDGEMENTS We thank CAPES (Brazil) for the financial support. CONFLICT OF INTEREST The authors declare that there is no conflict of interest that could be perceived as prejudicial to the impartiality of the reported research. 61 REFERENCES Andersen, M.L., Tufik, S., 2015. Rodent model as tools in Ethical biomedical research, Rodent Model as Tools in Ethical Biomedical Research. doi:10.1007/978-3-319-11578-8 Bale, T.L., Davis, A.M., Auger, A.P., Dorsa, D.M., McCarthy, M.M., 2001. CNS region- specific oxytocin receptor expression: importance in regulation of anxiety and sex behavior. J. Neurosci. 21, 2546–2552. Becker, R.O., Lazzari, V.M., Menezes, I.C., Morris, M., Rigatto, K., Lucion, A.B., Rasia- Filho, A.A., Giovenardi, M., 2013. Sexual behavior and dendritic spine density of posterodorsal medial amygdala neurons in oxytocin knockout female mice. Behav. Brain Res. 256, 95–100. doi:10.1016/j.bbr.2013.07.034 Bielsky, I.F., Young, L.J., 2004. Oxytocin, vasopressin, and social recognition in mammals. Peptides 25, 1565–1574. doi:10.1016/j.peptides.2004.05.019 Chiu, K., Lau, W.M., Lau, H.T., So, K., Chang, R.C., 2007. Micro-dissection of Rat Brain for RNA or Protein Extraction from Specific Brain Region 3–5. doi:10.3791/269 Choleris, E., Clipperton-Allen, A.E., Phan, A., Kavaliers, M., 2009. Neuroendocrinology of social information processing in rats and mice. Front. Neuroendocrinol. 30, 442–459. doi:10.1016/j.yfrne.2009.05.003 Choleris, E., Clipperton-Allen, A.E., Phan, A., Valsecchi, P., Kavaliers, M., 2012. Estrogenic involvement in social learning, social recognition and pathogen avoidance. Front. Neuroendocrinol. 33, 140–159. doi:10.1016/j.yfrne.2012.02.001 Choleris, E., Gustafsson, J.-Å., Korach, K.S., Muglia, L.J., Pfaff, D.W., Ogawa, S., 2003. An estrogen-dependent four-gene micronet regulating social recognition: a study with oxytocin and estrogen receptor-alpha and -beta knockout mice. Proc. Natl. Acad. Sci. U. S. A. 100, 6192–6197. doi:10.1073/pnas.0631699100 62 Engelmann, M., Landgraf, R., 1994. Microdialysis Administration of Vasopressin Into the Septum Improves Social Recognition in Brattleboro Rats. Physiol. Behav. 55, 145–149. Ferguson, J.N., Aldag, J.M., Insel, T.R., Young, L.J., 2001. Oxytocin in the Medial Amygdala is Essential for Social Recognition in the Mouse. J. Neurosci. 21, 8278–8285. Ferguson, J.N., Young, L.J., Hearn, E.F., Matzuk, M.M., Insel, T.R., Winslow, J.T., 2000. Social amnesia in mice lacking the oxytocin gene. Nat. Genet. 25, 284–8. doi:10.1038/77040 Gimpl, G., Fahrenholz, F., Gene, C., 2001. The Oxytocin Receptor System: Structure, Function, and Regulation. Physiol. Rev. 81, 629–683. Guastella, A.J., Kenyon, A.R., Unkelbach, C., Alvares, G.A., Hickie, I.B., 2011. Arginine Vasopressin selectively enhances recognition of sexual cues in male humans. Psychoneuroendocrinology 36, 294–297. doi:10.1016/j.psyneuen.2010.07.023 Insel, T.R., Fernald, R.D., 2004. How the brain processes social information: Searching for the Social Brain. Annu. Rev. Neurosci. 27, 697–722. doi:10.1146/annurev.neuro.27.070203.144148 Insel, T.R., Young, L.J., 2001. The neurobiology of attachment. Nat. Rev. Neurosci. 2, 129– 136. doi:10.1038/35053579 Lazzari, V.M., Becker, R.O., de Azevedo, M.S., Morris, M., Rigatto, K., Almeida, S., Lucion, A.B., Giovenardi, M., 2013. Oxytocin modulates social interaction but is not essential for sexual behavior in male mice. Behav. Brain Res. 244, 130–136. doi:10.1016/j.bbr.2013.01.025 Lee, K.N., Chirwa, S., 2015. Blocking dopaminergic signaling soon after learning impairs memory consolidation in Guinea Pigs. PLoS One 10, 1–15. doi:10.1371/journal.pone.0135578 63 Livak, K.J., Schmittgen, T.D., 2001. Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25, 402–408. doi:10.1006/meth.2001.1262 Matsushita, H., Tomizawa, K., Okimoto, N., Nishiki, T.-I., Ohmori, I., Matsui, H., 2010. Oxytocin mediates the antidepressant effects of mating behavior in male mice. Neurosci. Res. 68, 151–153. doi:10.1016/j.neures.2010.06.007 Moura, A.C. De, Lazzari, V.M., Agnes, G., Almeida, S., Giovenardi, M., Veiga, A.B.G. Da, 2014. Transcriptional expression study in the central nervous system of rats: what gene should be used as internal control? Einstein (São Paulo) 12, 336–341. doi:10.1590/S1679-45082014AO3042 Owen, S.F., Tuncdemir, S.N., Bader, P.L., Tirko, N.N., Fishell, G., Tsien, R.W., 2013. Oxytocin enhances hippocampal spike transmission by modulating fast-spiking interneurons. Nature 500, 458–62. doi:10.1038/nature12330 Ozaki, Y., Nomura, M., Saito, J., Luedke, C.E., Muglia, L.J., Matsumoto, T., Ogawa, S., Ueta, Y., Pfaff, D.W., 2004. Expression of the arginine vasopressin gene in response to salt loading in oxytocin gene knockout mice. J. Neuroendocrinol. 16, 39–44. doi:10.1111/j.1365-2826.2004.01119.x Pagani, J.H., Zhao, M., Cui, Z., Avram, S.K.W., Caruana, D.A., Dudek, S.M., 3rd, W.S.Y., 2015. Role of the Vasopressin 1b Receptor in Rodent Aggressive Behavior and Synaptic Plasticity in Hippocampal Area CA2. Mol. Psychiatry 20, 490–499. doi:10.1038/mp.2014.47. Paxinos, G., Franklin, K.B.J., 2012. Paxinos and Franklin’s the Mouse Brain in Stereotaxic Coordinates, São Paulo, Academic Press. Rocchetti, J., Isingrini, E., Dal Bo, G., Sagheby, S., Menegaux, A., Tronche, F., Levesque, D., Moquin, L., Gratton, A., Wong, T.P., Rubinstein, M., Giros, B., 2015. Presynaptic D2 64 dopamine receptors control long-term depression expression and memory processes in the temporal hippocampus. Biol. Psychiatry 77, 513–525. doi:10.1016/j.biopsych.2014.03.013 Skuse, D.H., Gallagher, L., 2009. Dopaminergic-neuropeptide interactions in the social brain. Trends Cogn. Sci. 13, 27–35. doi:10.1016/j.tics.2008.09.007 Stevenson, E.L., Caldwell, H.K., 2012. The vasopressin 1b receptor and the neural regulation of social behavior. Horm. Behav. 61, 277–282. doi:10.1016/j.yhbeh.2011.11.009 Wide, J.K., Hanratty, K., Ting, J., Galea, L.A.M., 2004. High level estradiol impairs and low level estradiol facilitates non-spatial working memory 155, 45–53. doi:10.1016/j.bbr.2004.04.001 Winslow, J.T., Insel, T.R., 2004. Neuroendocrine basis of social recognition. Curr. Opin. Neurobiol. 14, 248–253. doi:10.1016/j.conb.2004.03.009 Winslow, J.T., Insel, T.R., 2002. The social deficits of the oxytocin knockout mouse. Neuropeptides 36, 221–229. doi:10.1054/npep.2002.0909 Young III, W.S., Shepard, E., Amico, J., Hennighausen, L., Wagner, K.-U., LaMarca, M.E., McKinney, C., Ginns, E.I., 1996. Deficiency in Mouse Oxytocin Prevents Milk Ejection,but not Fertility or Parturition. J. Neuroendocrinol. 8, 847–853. doi:10.1046/j.1365-2826.1996.05266.x Zimmermann-Peruzatto, J.M., Lazzari, V.M., Agnes, G., Becker, R.O., de Moura, A.C., Guedes, R.P., Lucion, A.B., Almeida, S., Giovenardi, M., 2016. The Impact of Oxytocin Gene Knockout on Sexual Behavior and Gene Expression Related to Neuroendocrine Systems in the Brain of Female Mice. Cell. Mol. Neurobiol. doi:10.1007/s10571-016- 0419-3 65 Figure 1. The hippocampal relative gene expression of each studied receptor. The oxytocin receptor (OTR) gene expression levels are compared between WT (n=8) and OTKO (n=8). The dopamine receptor 2 (D2R) gene expression levels are shown in WT (n=8) and OTKO (n=7). The vasopressin receptor 1a (V1aR) gene expression levels are compare between WT (n=6) and OTKO (n=6). The vasopressin receptor 1b (V1bR) gene expression levels are shown in WT (n=5) and OTKO (n=6). The estrogen alpha receptor (ERa) gene expression levels are shown in WT (n=8) and OTKO (n=7), and the estrogen beta receptor (ERb) gene expression levels are compared between WT (n=8) and OTKO (n=6). The data are expressed as the mean [±SEM]. Mann-Whitney test (U test of Mann-Whitney). * P<0.05, significant difference from WT Figure 2. The hypothalamic relative gene expression levels of vasopressin (AVP) are compared between WT (n=5) and OTKO (n=8). The data are expressed as the mean [±SEM]. Mann-Whitney test (U test of Mann-Whitney). * P<0.05 Table 1. Primers used for SYBR® Green assays Table 2. The relative gene expression levels of the receptors in the hypothalamus (HPT), prefrontal cortex (PFC) and olfactory bulb (OB). NA = no amplification detected. The data are expressed as the mean [±SEM]. Mann-Whitney test (U test of Mann-Whitney). * P<0.05, significant difference between groups 66 Figure 1. WT OTKO 0 20 40 60 80 100 O T R m R N A WT OTKO 0 2 4 6 8 10 12 D 2 R m R N A WT OTKO 0.0 0.5 1.0 1.5 2.0 2.5 V 1 a R m R N A WT OTKO 0.0 0.5 1.0 1.5 2.0 2.5 V 1 b R m R N A WT OTKO 0 1 2 3 4 E R a m R N A WT OTKO 0 1 2 3 4 E R b m R N A * * * Figure 2. WT OTKO 0.0 0.5 1.0 1.5 2.0 *AV P m R N A 67 Table 1. Target Primer Sequencies OTR 5’ - CGATTGCTGGGCGGTCTTCA - 3’ 5’ - CCGCCGCTGCCGTCTTGAG - 3’ D2R 5’ - CTCAGGAGCTGGAAATGGAG - 3’ 5’ - CATGCCCATTCTTTTCTGGT - 3’ ERa 5’ - CAAGAACGTTGTGCCCCTCT - 3’ 5’ - TGTAAGGAATGTGCTGAAGTGGA - 3’ ERb 5’ - GGGACATGTACCCTAGCATCG - 3’ 5’ - TGGAAAGTACAACGAGAGCCT - 3’ AVP 5’ - TCGCCATGATGCTCAACACT - 3’ 5’ - TCAGCTCCATGTCGGATGTG - 3’ ActB 5’ - TATGCCAACACAGTGCTGTCTGG - 3’ 5’ - TACTCCTGCTTGCTGATCCACAT - 3’ CypA 5’ - TATCTGCACTGGCAAGACTGAGTG - 3’ 5’ - CTTCTTGCTGGTCTTGCCATTCC - 3’ Table 2. Area Receptor WT OTKO U P HPT (n = 4 to 7) (n = 8 to 9) OTR 1.63 ± 0.64 1.01 ± 0.30 20.00 0.46 V1aR 1.16 ± 0.23 1.82 ± 0.40 17.00 0.23 V1bR NA NA D2R 1.05 ± 0.14 0.89 ± 0.12 20.00 0.46 ERa 1.76 ± 0.98 1.04 ± 0.20 20.00 1.00 ERb 0.66 ± 0.19 0.60 ± 0.17 15.00 0.71 PFC (n = 5 to 10) (n = 5 to 9) OTR 1.99 ± 0.92 0.45 ± 0.11 17.00 0.13 V1aR 1.04 ± 0.14 1.16 ± 0.28 11.00 0.84 V1bR NA NA D2R 2.85 ± 1.10 2.22 ± 1.36 44.00 0.97 ERa 1.36 ± 0.53 0.86 ± 0.14 18.00 0.73 ERb 1.23 ± 0.30 4.73 ± 1.06 8.00 0.02* OB (n = 6 to 9) (n = 5 to 7) OTR 1.49 ± 0.38 1.73 ± 0.83 26.00 0.87 V1aR 1.26 ± 0.38 0.99 ± 0.21 14.00 0.93 V1bR NA NA D2R 1.53 ± 0.53 1.67 ± 0.63 31.00 1.00 ERa 2.08 ± 0.58 0.81 ± 0.38 10.00 0.17 ERb 1.91 ± 0.73 1.07 ± 0.51 26.00 0.60 68 4.3 ARTIGO 3: Sexual experience induces spine-specific changes in CA2 pyramidal neurons of male mice Virginia Meneghini Lazzari, Roberta Oriques Becker, Marcia Giovenardi, Alberto Rasia Filho Revista a ser submetido: Neural Plasticity Fator de impacto: 3.568 Author Guidelines: https://www.hindawi.com/journals/np/guidelines/ 69 SEXUAL EXPERIENCE INDUCES SPINE-SPECIFIC CHANGES IN CA2 PYRAMIDAL NEURONS OF MALE MICE Virginia Meneghini Lazzari 1,4 , Roberta Oriques Becker 1 , Marcia Giovenardi 1,3 , Alberto Rasia Filho 1,3 * 1 Programa de Pós-Graduação em Ciências da Saúde, Universidade Federal de Ciências da Saúde de Porto Alegre (UFCSPA), Porto Alegre, Brasil 2 Doutora em Fisiologia, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brasil 3 Programa de Pós-Graduação em Biociências, Universidade Federal de Ciências da Saúde de Porto Alegre (UFCSPA), Porto Alegre, Brasil 4 Centro Universitário Ritter dos Reis (UniRitter), Porto Alegre, Brasil * Corresponding author 70 ABSTRACT The modulation of male sexual behavior involves contextual processing of sexual encounters and individual memories. Pyramidal neurons of hippocampal area CA2 are critical for social memory processing and highly express oxytocin (OT) receptors. OT is important to the modulation of neural circuits for social behaviors and the spine geometry can influence synaptic processing. Here, we describe the effects of sexual experience on density and shape of dendritic spines in the CA2 of male mice, with Golgi method analysis. The males were allocated into four groups: wild-type naïve (WT/Naïve), OT knockout naïve (OTKO/Naïve), WT sexually experienced (WT/SexExp) and OTKO sexually experienced (OTKO/SexExp). Even plasticity in the CA2 seems to be tightly regulated, sexual experience was able to reduce the amount of stubby/wide spines, but did not affect density or other spines in CA2. Sexually experienced OTKO had a reduction of the number of stubby/wide smaller than WT animals. Perhaps the plasticity adaptation to sexual experience occurred better in WT animals than in OTKOs. Our results show it is highly likely that the spine-specific changes induced by sexual experience alter the normal synaptic processing and excitatory responses in the CA2, which can be important to consolidate the memory of sexual experience. Keywords: spine density, spine shape, synaptic plasticity, hippocampus, oxytocin. 71 Male mating behavior is managed by a complex interaction between different brain systems, which process sensory inputs, regulate reward and motivation, and integrate hormonal signals [1]. Although androgens play a major role in the regulation of sexual behavior, brain systems that integrate steroid hormone signals into behavioral outcome are modified by sexual experience. Sexual experience has long-term effects on anticipatory and consummatory male sexual behaviors [2]. The modulation of masculine sexual behavior also involves contextual processing of sexual encounters and individual memories [3]. Previous study [4] demonstrated anatomical and behavioral results that reveal pyramidal neurons of hippocampal area CA2 are critical for sociocognitive memory processing. CA2 pyramidal neurons demonstrate prominent dendritic sodium spikes and highly express OT receptors [5]. Studies showed that OT is important to the synaptic plasticity and modulation of neural circuits for social interactions [6,7]. In this context, there are several new findings on OT neuromodulation of synaptic transmission in the hippocampus (rewied in [8]). In the CA2 region, Pagani et al. [9] showed neuromodulatory effects that were mediated by V1b receptors and OT receptors by decreasing threshold for potentiation and by rendering neurons more sensitive to external stimulation. Dendritic spines arise as small protrusions from the dendritic shaft and receive inputs from excitatory axons [10,11]. The shape of a dendritic spine depends on the synaptic demand upon it [12] and the spine geometry can influence the synaptic processing [13]. At the cellular level, dendritic spines have shapes ranging from small stubby protrusions to large mushroom- like form and are considered postsynaptic elements with critical properties for the information processing (reviewed in [11]). The advance on understanding of the relationship between hippocampus, OT and sexual behavior modulation on synaptic plasticity was the aim of this work. Here, we describe 72 new data on the effects of sexual experience on density and shape of dendritic spines in the CA2 of male mice. 1. MATERIAL AND METHODS Mice of an offspring from a backcrossed stock obtained from Dr. W. Scott Young (B6; 129S-Oxttm1Wsy/J; NIMH, USA) were used to this work. OTKO mice was developed by gene targeting as described by Young [14]. All animals were littermates from heterozygous breeders (C57BL/6 mice). Genotyping was described in details previously [15]. Adult males (n = 24) weighing 25 to 35 g, with 5 to 8 months old were housed in groups with free access to food and water. All subjects were maintained in a temperature controlled room (22 ± 1ºC) on a 12:12 light–dark cycle with the lights off at 5 p.m. The procedures were conducted in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (8 th edition, 2011) and the local Ethics Committee (UFCSPA, Brazil, Protocol No. 920/09 and 130/13). At the start of the experimental phase, male mice were allocated into 4 groups: 2 groups of sexually naïve males, consisting of wild-type (WT/Naïve, n=5) and OTKO males (OTKO/Naïve, n=6), and 2 groups of sexually experienced males, consisting of WT (WT/SexExp, n=5) and OTKO males (OTKO/SexExp, n=6). For the sexual experience, each male was placed in a clean cage with two female mice along 3 weeks. The females selected were previously monitored for the regularity of estrous cycle along 2 weeks, to safeguard that males had access to females sexually receptive. The preparation of histological samples was previously described [16]. Briefly, males were deeply anesthetized, brains were fixed, sectioned coronally (150-μm thick) and put in 3 % potassium dichromate and 1.5 % silver nitrate solutions (Merck, Germany). Sections were rinsed, dehydrated, cleared, mounted on slides and covered with synthetic balsam and 73 coverslips. The selected brain sections were approximately 1.46 to 1.94 mm posterior to the bregma [17]. The including criteria for the study of CA2 neurons were: (a) to be undoubtedly located within the boundaries of the intended area, as shown in Figure 1; (b) to be relatively isolated from neighboring impregnated cells to avoid ―tangled‖ dendrites; (c) dendrites should have well-impregnated and defined borders; and (d) spines should be clearly distinguishable from the background (adapted from [7]). The first 10 µm of proximal dendrites that fulfilled these criteria had their spines drawn along the different focal planes in ―z‖ using a camera lucida (2000x; i.e., 100x oil- immersion objective lens and 20x ocular lens) coupled to an optic microscope (Olympus BX- 41, Japan). For each male, 2-8 different dendrites were studied with 1 dendrite per sampled neuron. The 3 main differently shaped spines (thin, mushroom, stubby/wide) were identified and counted from these samples. Other spine shapes (ramified or atypical) were not usually seen. After this procedure, three-dimensional dendritic lengths were measured from the same microscopic images (400x; Olympus BX-61, Japan) and the images of the selected dendrites were captured by a high-resolution digital camera (CCD DP72, Japan) and measured using the Image Pro Plus 7.0 computer software (Media Cybernetics, USA). Data were submited to a square root transformation to fulfill the formal requirements of normal distribution and homocedasticity. Data (presented as mean + standard deviation, SD) were tested for the normality distribution and homocedasticity using the Kolmogorov- Smirnov test and the Bartlett test, respectively. Spine density was defined as the number of spines per unit length of dendritic segment (in µm; [18]). The overall density of dendritic spines was submitted to a two-way analysis of variance (ANOVA) test for repeated measures followed by the Bonferroni test. The number of each type of dendritic spine was submitted to a one-way ANOVA and the Tukey post hoc test for multiple comparisons. Statistical level of 74 significance was set as P < 0.05 in all cases. Statistical software was GraphPad Prism version 5.0 (GraphPad Software, USA). 2. RESULTS Fig. 2 shows representative images of Golgi-impregnated spine neurons in the CA2 of all studied groups. Fig. 3 shows the density of dendritic spines in the CA2 had no significant difference when compared the OTKO and WT experimental groups [F (1, 17) = 0.10, P = 0.75], the sexual experience [F (1, 17) = 2.94, P = 0.10], and the interaction of these two factors [F(1, 17) = 0.93, P =0.35]. On the other hand, the sexual experience modified the number of the stubby/wide spines in CA2 (Fig. 4). Accordingly, males submitted to sexual experience showed marked reductions in the proximal density of stubby/wide spines [F(3, 17) = 22.36, P < 0.00001]. The Tukey post hoc comparisons showed that sexually experienced groups have a significant decrease in the proximal density of stubby/wide spines when compared to their naïve groups. WT experienced males had ~31.1% stubby/wide fewer than WT naïve group and OTKO experienced males had a reduction of ~29.4% stubby/wide density than naïve OTKOs. Moreover, OTKO sexually experienced males had higher values stubby/wide spines than WT sexually experienced ones (27.8% and 17.3%, respectively). Comparisons of mushroom spines were not different between the experimental groups [F(3, 17) = 1.63, P = 0.87] and thin spines also showed no significant differences between the experimental groups [F(3, 17) = 1.75, P = 0.67]. 3. DISCUSSION Whereas the histological features, the connectivity and the physiology of field CA3 and CA1 have been investigated by a number of studies, field CA2, possibly in view of its 75 small size, has been largely ignored or considered together with field CA3 [19]. However, some exciting new discoveries on the properties of CA2 neurons and their role in behavior call attention to this area recently [20]. The present findings add new data on the brain reorganization induced by sexual experience and demonstrate spine-specific changes in the CA2 of adult male mice. For the first time, the density of proximal dendritic spines and the percentage of differently shaped spines of CA2 pyramidal neurons are described in literature. Our results agree with the current understanding that excitatory synaptic plasticity in the area CA2 is suppressed under most conditions [20]. Even plasticity in the CA2 seems to be tightly regulated, sexual experience was able to alter the amount of stubby/wide spines in the area. However, the total density dendritic spines in CA2 was not affected by sexual experience, as well as mushroom-like and thin spines shape. The different synaptic inputs and neurotransmitter release that reach the CA2 neurons might code the complex processing of contextual memories of sexual encounters of the animal. The previous study [21] with sexual experienced male mice indicated that sexual interaction might improve the long-term recognition memory and contribute to the formation of stable recognition memory until 48 h. However, although sexual activity is able to affect neurogenesis and enhance hippocampal cell proliferation [22], its mechanism of action, and effects on learning and memory remain uncertain [21]. The general effect of sexual experience in dendritic spines were elucidated by Glasper et. al (2015) that demonstrated that mating increases dendritic spine density in the medial prefrontal cortex and the dentate gyrus, but not in the orbitofrontal cortex or CA1 region in male rats [23]. They did not study the CA2 region, but our results are complementary to their in the context where we show that CA2 region did not altered dendritic spines density. 76 Lines of evidences showed OT is released in the hippocampus during mating [24] and enhances synaptic plasticity [6]. Surprisingly, in our results OT does not appear to influence the density and shapes of CA2 pyramidal neurons in naïve males. Perhaps the effect of OT reported in these previous studies involves hippocampal areas other than CA2 or different effects in CA2 neuronal plasticity, such as molecular or electrical alterations. The role of OT is not clear in this context, but sexually experienced OTKO had a reduction of the number of stubby/wide spines smaller than WT animals. Perhaps the plasticity adaptation to sexual experience occurred better in animals with OT than in the ones without it. Owen et. al (2013) found a mechanism by which OT can filter signals through the hippocampus, increasing the fidelity of evoked spike transmission (EPSP-spike coupling) in the postsynaptic CA1 pyramidal neurons [25]. Maybe OTKO animals have the fidelity of neural transmission less efficient and the plasticity adaptation not occurred as properly in these animals. The lack of OT, on the other hand, do not reflected in the dendritic spine shapes or density in CA2 neurons of naïve males, indicating that OT role can be more prominent in new situations that require neuronal adaptation. The shape of a dendritic spine depends on the specific synaptic demand upon it [12] and can influence the synaptic processing [26]. The forward and back propagation of action potentials has been shown to be sensitive to dendritic morphology [27]. Longer spines have a lower density of postsynaptic glutamate receptors, and respond to flash photolysis of caged glutamate with a smaller inward current recorded at the soma than do short ones. The largest responses are seen with stubby or shaft synapses [12]. Stubby/wide spines are considered ―immature‖ shapes [28], 2007) and it is likely that they impose a relatively low resistance to synaptic input and fast voltage propagation to the adjacent dendrite [26]. Sexually experienced animals have less stubby/wide spines than naïve ones. This result can indicate an adaptive way to dampening the spikes and thus restrict the CA2 neural activity in these 77 animals. On the other hand, the density of dendritic spines did not change with sexual experience, which indicates that along with the reduction of stubby/wide spines a compensatory increase occurred in other types of spines. In conclusion, sexual experience promoted a reduction in stubby/wide spine number, but not affected other spines or the density of dendritic spines in CA2 pyramidal neurons. It is highly likely that the spine-specific changes induced by sexual experience alter the normal synaptic processing, plasticity, and strength for excitatory responses in the CA2, which can be important to consolidate the memory of sexual experience. These data are relevant for the neuronal structural modulation made by sexual experience and the connectivity of the social behavior network in the male brain. 78 4. REFERENCES [1] J.G. Pfaus, T.E. Kippin, S. Centeno, Conditioning and sexual behavior: a review., Horm. Behav. 40 (2001) 291–321. doi:10.1006/hbeh.2001.1686\nS0018- 506X(01)91686-1 [pii]. [2] W.T. Swaney, B.N. Dubose, J.P. Curley, F.A. Champagne, Sexual experience affects reproductive behavior and preoptic androgen receptors in male mice, Horm. Behav. 61 (2012) 472–478. doi:10.1016/j.yhbeh.2012.01.001. [3] A.A. Rasia-Filho, D. Haas, A.P. de Oliveira, J. de Castilhos, R. Frey, D. Stein, V.M. Lazzari, F. Back, G.N. Pires, E. Pavesi, E.C. Winkelmann-Duarte, M. Giovenardi, Morphological and Functional Features of the Sex Steroid-Responsive Posterodorsal Medial Amygdala of Adult Rats, Mini Rev. Med. Chem. 12 (2012) 1090–1106. doi:10.2174/138955712802762211. [4] F.L. Hitti, S.A. Siegelbaum, The hippocampal CA2 region is essential for social memory, Nature. 508 (2014) 88–92. doi:10.1038/nature13028. [5] Q. Sun, K. V Srinivas, A. Sotayo, S. A Siegelbaum, Dendritic Na(+) spikes enable cortical input to drive action potential output from hippocampal CA2 pyramidal neurons., Elife. 3 (2014) 1–24. doi:10.7554/eLife.04551. [6] D.T. Theodosis, C. Montagnese, F. Rodriguez, J.D. Vincent, D.A. Poulain, Oxytocin induces morphological plasticity in the adult hypothalamo-neurohypophysial system., Nature. 322 (1986) 738–40. doi:10.1038/322738a0. [7] R.O. Becker, A. Dall’Oglio, K. Rigatto, M. Giovenardi, A.A. Rasia-Filho, Differently shaped spines increase in the posterodorsal medial amygdala of oxytocin knockout female mice, Neurosci. Res. 101 (2015) 53–56. doi:10.1016/j.neures.2015.07.001. 79 [8] R. Stoop, Neuromodulation by oxytocin and vasopressin in the central nervous system as a basis for their rapid behavioral effects, Curr. Opin. Neurobiol. 29 (2014) 187–193. doi:10.1016/j.conb.2014.09.012. [9] J.H. Pagani, M. Zhao, Z. Cui, S.K.W. Avram, D.A. Caruana, S.M. Dudek, W.S.Y. 3rd, Role of the Vasopressin 1b Receptor in Rodent Aggressive Behavior and Synaptic Plasticity in Hippocampal Area CA2, Mol. Psychiatry. 20 (2015) 490–499. doi:10.1038/mp.2014.47. [10] J.N. Bourne, K.M. Harris, Balancing Structure and Funcion at Hippocampal Dendritic Spines, Annu Rev Neurosci. 31 (2008) 47–67. doi:10.1146/annurev.neuro.31.060407.125646.Balancing. [11] N.L. Rochefort, A. Konnerth, Dendritic spines: from structure to in vivo function., EMBO Rep. 13 (2012) 699–708. doi:10.1038/embor.2012.102. [12] M. Segal, Dendritic spines, synaptic plasticity and neuronal survival: Activity shapes dendritic spines to enhance neuronal viability, Eur. J. Neurosci. 31 (2010) 2178–2184. doi:10.1111/j.1460-9568.2010.07270.x. [13] M. Zancan, A. Dall, E. Quagliotto, A.A. Rasia-filho, Castration alters the number and structure of dendritic spines in the male posterodorsal medial amygdala, (2016). doi:10.1111/ejn.13460. [14] W.S. Young III, E. Shepard, J. Amico, L. Hennighausen, K.-U. Wagner, M.E. LaMarca, C. McKinney, E.I. Ginns, Deficiency in Mouse Oxytocin Prevents Milk Ejection,but not Fertility or Parturition, J. Neuroendocrinol. 8 (1996) 847–853. doi:10.1046/j.1365-2826.1996.05266.x. [15] V.M. Lazzari, R.O. Becker, M.S. de Azevedo, M. Morris, K. Rigatto, S. Almeida, A.B. Lucion, M. Giovenardi, Oxytocin modulates social interaction but is not essential for 80 sexual behavior in male mice, Behav. Brain Res. 244 (2013) 130–136. doi:10.1016/j.bbr.2013.01.025. [16] R.O. Becker, V.M. Lazzari, I.C. Menezes, M. Morris, K. Rigatto, A.B. Lucion, A.A. Rasia-Filho, M. Giovenardi, Sexual behavior and dendritic spine density of posterodorsal medial amygdala neurons in oxytocin knockout female mice, Behav. Brain Res. 256 (2013) 95–100. doi:10.1016/j.bbr.2013.07.034. [17] G. Paxinos, K.B.J. Franklin, Paxinos and Franklin’s the Mouse Brain in Stereotaxic Coordinates, 2012. https://www.elsevier.com/books/paxinos-and-franklins-the-mouse- brain-in-stereotaxic-coordinates/paxinos/978-0-12-391057-8. [18] A.A. Rasia-Filho, C. Fabian, K.M. Rigoti, M. Achaval, Influence of sex, estrous cycle and motherhood on dendritic spine density in the rat medial amygdala revealed by the Golgi method, Neuroscience. 126 (2004) 839–847. doi:10.1016/j.neuroscience.2004.04.009. [19] R. Bartesaghi, L. Ravasi, Pyramidal neuron types in field CA2 of the guinea pig, Brain Res. Bull. 50 (1999) 263–273. doi:10.1016/S0361-9230(99)00198-7. [20] S.M. Dudek, G.M. Alexander, S. Farris, Rediscovering area CA2: unique properties and functions, Nat. Rev. Neurosci. 17 (2016) 89–102. doi:10.1038/nrn.2015.22. [21] J.-I. Kim, J.W. Lee, Y.A. Lee, D.-H. Lee, N.S. Han, Y.-K. Choi, B.R. Hwang, H.J. Kim, J.S. Han, Sexual activity counteracts the suppressive effects of chronic stress on adult hippocampal neurogenesis and recognition memory., Brain Res. 1538 (2013) 26– 40. doi:10.1016/j.brainres.2013.09.007. [22] E.R. Glasper, E. Gould, Sexual experience restores age-related decline in adult neurogenesis and hippocampal function, Hippocampus. 23 (2013) 303–312. doi:10.1002/hipo.22090. 81 [23] E.R. Glasper, E.A. LaMarca, M.E. Bocarsly, M. Fasolino, M. Opendak, E. Gould, Sexual experience enhances cognitive flexibility and dendritic spine density in the medial prefrontal cortex, Neurobiol. Learn. Mem. 125 (2015) 73–79. doi:10.1016/j.nlm.2015.07.007. [24] M. Waldherr, I.D. Neumann, Centrally released oxytocin mediates mating-induced anxiolysis in male rats., Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 16681–4. doi:10.1073/pnas.0705860104. [25] S.F. Owen, S.N. Tuncdemir, P.L. Bader, N.N. Tirko, G. Fishell, R.W. Tsien, Oxytocin enhances hippocampal spike transmission by modulating fast-spiking interneurons., Nature. 500 (2013) 458–62. doi:10.1038/nature12330. [26] N. Spruston, M. Häusser, G. Stuart, Information Processing in Dendrites and Spines, in: Fundam. Neurosci. Fourth Ed., 2012: pp. 231–260. doi:10.1016/B978-0-12-385870- 2.00011-1. [27] R.A. Piskorowski, V. Chevaleyre, Synaptic integration by different dendritic compartments of hippocampal CA1 and CA2 pyramidal neurons, Cell. Mol. Life Sci. 69 (2012) 75–88. doi:10.1007/s00018-011-0769-4. [28] J. Bourne, K.M. Harris, Do thin spines learn to be mushroom spines that remember?, Curr. Opin. Neurobiol. 17 (2007) 381–386. doi:10.1016/j.conb.2007.04.009. 82 LEGENDS FIGURE 1. Coronal brain sections approximately 1.22 to 2.46 mm posterior to the bregma. Boundaries of the CA2 area (in red), in a ventral (a), intermediate (b) and dorsal (c) section. FIGURE 2. Representative images of Golgi-impregnated spine neurons from the CA2 of naïve control (WT/naïve), naïve oxytocin knockout (OTKO/naïve), sexually experienced control (WT/SexExp) and sexually experienced oxytocin knockout (WT/SexExp) male mice. Arrows point to differently shaped proximal dendritic spines classified as thin (t), mushroom (m) or stubby/wide (s). Bar = 2 µm. FIGURE 3. Values (mean ± standart deviation) of (A) the density of dendritic spines in the hippocampal CA2 area of wild type naïve (WT/Naïve, n = 5), oxytocin knockout naïve (OTKO/Naïve, n = 6), WT sexually experience (WT/SexExp, n = 5) and OTKO sexually experience (OTKO/SexExp, n=5) male mice. P ˃ 0.05 (ANOVA test followed by Bonferroni test). FIGURE 4. Mean values ± standart deviation of wild type naïve (WT/Naïve, n = 5), oxytocin knockout naïve (OTKO/Naïve, n = 6), WT sexually experience (WT/SexExp, n = 5) and OTKO sexually experience (OTKO/SexExp, n=5) male mice shapes of spines in 10 µm of proximal dendrites of CA2. *when compared to WT naïve group; ** when compared to OTKO naïve group; # when compared to WT sexually experienced group. P < 0.0001 (ANOVA test followed by Tukey test). 83 FIGURE 1. A B C 84 FIGURE 2. FIGURE 3. Density Naïve SexExp 0.0 0.5 1.0 1.5 2.0 WT OTKO D e n d ri ti c s p in e s /µ m 85 FIGURE 4. CA2 Thin Mushroom Stubby/Wide 0 1 2 3 4 WT/naïve OTKO/naïve WT/SexExp OTKO/SexExp * ** # N u m b e r o f s p in e s 86 5 CONCLUSÕES E CONSIDERAÇÕES FINAIS O papel da ocitocina nas interações sociais já é estudado há algum tempo, porém ainda se sabe pouco sobre os mecanismos de modulação deste neuropeptídeo nos padrões comportamentais. O anseio por uma explicação se baseia na possibilidade de uma ação translacional, que explique não só os padrões comportamentais de cobaias, mas também dos seres humanos e das doenças que prejudicam a sociabilidade. Os resultados encontrados nos testes de interação social provam que a ocitocina possui papel fundamental para este correto desfecho comportamental, já que os animais nocautes para a ocitocina apresentaram menor interação social e comportamento agressivo reduzido, quando comparados aos controles. No comportamento sexual, parece que a ocitocina não possui um papel tão pronunciado em machos, pois os animais nocautes desenvolveram o comportamento normalmente e não apresentaram diferenças em relação ao grupo controle. Os animais que foram submetidos ao teste de comportamento sexual (artigo 1), e os animais experientes utilizados para a análise dos espinhos dendríticos (artigo 3), foram alocados com fêmeas para adquirir experiência sexual, nas mesmas condições. Na análise dos espinhos dendríticos, os grupos nocaute e controle experientes foram diferentes entre si apenas em relação ao número de espinhos do tipo stubby/wide. Apesar desta diferença encontrada nos espinhos, como o padrão comportamental sexual não foi diferente entre nocautes e controles (artigo 1), podemos inferir que estes espinhos não estão influenciando no desenvolvimento do comportamento sexual. Em animais virgens, os resultados encontrados mostram que a ocitocina não tem um papel pronunciado na plasticidade neuronal da área CA2 de animais inexperientes, já que os grupos controle e nocaute apresentavam padrões de espinhos dendríticos semelhantes. É possível que este resultado de redução de espinhos stubby/wide encontrado nos grupos experientes sexualmente esteja relacionado com a reação do animal frente à experiência social, de que forma ocorre o processamento desta experiência e não a como ele desenvolve o comportamento sexual. Neste contexto, como o grupo controle obteve uma redução de stubby/wide mais pronunciada que o grupo nocaute, parece que a ocitocina é importante para modular esta adaptação sináptica, que ocorre de forma menos eficiente no grupo nocaute. Com os resultados encontrados nos estudos realizados, hipotetizamos que este tempo de convívio com as fêmeas, onde os animais estão livres para explorar o outro animal, cheirar, 87 perseguir, reconhecer o animal em questão, pode ter alterado o padrão de espinhos do tipo stubby/wide, e esta alteração poderia ser uma adaptação ao comportamento de interação social e não ao comportamento sexual em si. Porém, com as condições experimentais desenvolvidas neste trabalho, não podemos confirmar esta hipótese, para tal, seriam necessários mais estudos. Em relação à expressão gênica do sistema nervoso de animais nocautes para a ocitocina, conseguimos concluir que a área mais afetada dentre as quatro áreas estudadas foi o hipocampo e que o neuropeptídeo mais intimamente relacionado à ocitocina foi a vasopressina. No hipocampo a ausência de ocitocina não apenas aumenta o padrão de expressão de receptores para ocitocina como também reduz dos receptores de dopamina e vasopressina 1b. Além disso, o nocauteamento da ocitocina reduziu o padrão de transcrição gênica hipotalâmica e a concentração plasmática de vasopressina. Possivelmente, estas alterações de expressão gênica contribuem para as alterações comportamentais destes animais e, portanto, não apenas a ocitocina possui um papel importante nos comportamentos sociais, mas também aos neurotransmissores a ela relacionados, como a vasopressina e a dopamina. Este estudo contribuiu para a construção do conhecimento sobre as áreas relacionadas à modulação de comportamentos sociais e sobre o papel desempenhado pela ocitocina e outros neurotransmissores envolvidos neste contexto. Concluímos que a ocitocina não é essencial para o comportamento sexual de machos, mas possui papel importante no comportamento de interação social. Possivelmente, as alterações comportamentais encontradas em animais nocautes para a ocitocina são fruto de alterações gênicas e morfológicas no hipocampo, área pertencente ao circuito neural responsável pela modulação dos comportamentos sociais e essencial para o processamento de informações sensoriais e memórias sociais. 88 6 ANEXO A: Pareceres de Aprovação do CEP 89 90 91 92 7 ANEXO B: Licenças para utilização de figuras 93